TRIM74 cdna clone
TRIM74 cDNA Clone
Gene Names
TRIM74; TRIM50C
Synonyms
TRIM74; TRIM74 cDNA Clone; TRIM74 cdna clone
Sequence
atggcttggcaggtgagcctgctggagctggaggaccggcttcagtgtcccatctgcctggaggtcttcaaggagtccctaatgctacagtgcggccactcctactgcaagggctgcctggtttccctgtcctaccacctggacaccaaggtgcgctgccccatgtgctggcaggtggtggacggcagcagctccttgcccaacgtctccctggcctgggtgatcgaagccctgaggctccctggggacccggagcccaaggtctgcgtgcaccaccggaacccgctcagccttttctgcgagaaggaccaggagctcatctgtggcctctgcggtctgctgggctcccaccaacaccacccggtcacgcccgtctccaccatctgcagccgcatgaaggaggagctcgcagccctcttctctgagctgaagcaggagcagaagaaggtggatgagctcatcgccaaactggtgaacaaccggacccgaatcgtcaatgagtcggatgtcttcagctgggtgatccgccgcgagttccaggagctgcgccacccggtggacgaggagaaggcccgctgcctggaggggatagggggtcacacccgtggcctggtggcctccctggacatgcagctggagcaggcccagggaacccgggagcggctggcccaagccgagtgtgtgctggaacagttcggaaatgaggaccaccatgagttcatctggttccactccatggcctccaggtaa
Sequence Length
750
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,419 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 74, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 74
NCBI Official Symbol
TRIM74
NCBI Official Synonym Symbols
TRIM50C
NCBI Protein Information
tripartite motif-containing protein 74
UniProt Protein Name
Tripartite motif-containing protein 74
Protein Family
UniProt Gene Name
TRIM74
UniProt Synonym Gene Names
TRIM50C
UniProt Entry Name
TRI74_HUMAN
Uniprot Description
TRIM74: Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 7q11.23
Research Articles on TRIM74
Similar Products
Product Notes
The TRIM74 trim74 (Catalog #AAA1277253) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttggc aggtgagcct gctggagctg gaggaccggc ttcagtgtcc catctgcctg gaggtcttca aggagtccct aatgctacag tgcggccact cctactgcaa gggctgcctg gtttccctgt cctaccacct ggacaccaag gtgcgctgcc ccatgtgctg gcaggtggtg gacggcagca gctccttgcc caacgtctcc ctggcctggg tgatcgaagc cctgaggctc cctggggacc cggagcccaa ggtctgcgtg caccaccgga acccgctcag ccttttctgc gagaaggacc aggagctcat ctgtggcctc tgcggtctgc tgggctccca ccaacaccac ccggtcacgc ccgtctccac catctgcagc cgcatgaagg aggagctcgc agccctcttc tctgagctga agcaggagca gaagaaggtg gatgagctca tcgccaaact ggtgaacaac cggacccgaa tcgtcaatga gtcggatgtc ttcagctggg tgatccgccg cgagttccag gagctgcgcc acccggtgga cgaggagaag gcccgctgcc tggaggggat agggggtcac acccgtggcc tggtggcctc cctggacatg cagctggagc aggcccaggg aacccgggag cggctggccc aagccgagtg tgtgctggaa cagttcggaa atgaggacca ccatgagttc atctggttcc actccatggc ctccaggtaa. It is sometimes possible for the material contained within the vial of "TRIM74, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
