Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM4 cdna clone

TRIM4 cDNA Clone

Gene Names
TRIM4; RNF87
Synonyms
TRIM4; TRIM4 cDNA Clone; TRIM4 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagctgaggacatccaggaggagttgacctgccccatctgcctggactatttccaggacccggtgtccatcgagtgcggccacaacttctgccgcggctgcctgcaccgcaactgggcgccgggcggcggcccgttcccctgccccgaatgtcggcacccatcggcgcccgccgcgctgcgacccaactgggccctggccaggctgactgagaagacgcagcgccggcgcctgggccccgtgcccccgggcctgtgcggccgccactgggagccgctgcggctcttctgcgaggacgaccagcggccagtgtgcctggtgtgcagggagtcccaggagcaccagactcacgccatggcacccatcgacgaggccttcgagagctaccgggagaaacttcttaagtctcagcgtaatctcgtggccaagatgaagaaagtcatgcatttacaggatgtagaagtgaagaacgccacacagtggaaggataagataaagagtcagcgaatgagaatcagcacggagttttcaaagctgcacaacttcctggttgaagaagaggacctgtttcttcagagattgaacaaagaagaagaagagacgaagaagaagctgaatgagaacacgttaaaactcaatcaaactatcgcttcattgaagaagctcatcttagaggtgggggagaagagccaggctcccaccctggagctgcttcagaatccaaaagaagtgttgaccaggagtgagatccaggatgtgaactattctcttgaagctgtaaaggtgaagacagtgtgccagataccattgatgaaggaaatgctaaagcgattccaagcaactaaaataaaaacacaaaaacaaaacaggcacaatatgtga
Sequence Length
885
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,194 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 4, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 4
NCBI Official Symbol
TRIM4
NCBI Official Synonym Symbols
RNF87
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM4
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM4
UniProt Gene Name
TRIM4
UniProt Synonym Gene Names
RNF87
UniProt Entry Name
TRIM4_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternatively spliced transcript variants that encode different isoforms have been described.[provided by RefSeq, Jul 2010]

Uniprot Description

TRIM4: is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternatively spliced transcript variants that encode different isoforms have been described.[provided by RefSeq, Jul 2010]

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 7q22-q31.1

Cellular Component: cytoplasm; plasma membrane

Research Articles on TRIM4

Similar Products

Product Notes

The TRIM4 trim4 (Catalog #AAA1266517) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctg aggacatcca ggaggagttg acctgcccca tctgcctgga ctatttccag gacccggtgt ccatcgagtg cggccacaac ttctgccgcg gctgcctgca ccgcaactgg gcgccgggcg gcggcccgtt cccctgcccc gaatgtcggc acccatcggc gcccgccgcg ctgcgaccca actgggccct ggccaggctg actgagaaga cgcagcgccg gcgcctgggc cccgtgcccc cgggcctgtg cggccgccac tgggagccgc tgcggctctt ctgcgaggac gaccagcggc cagtgtgcct ggtgtgcagg gagtcccagg agcaccagac tcacgccatg gcacccatcg acgaggcctt cgagagctac cgggagaaac ttcttaagtc tcagcgtaat ctcgtggcca agatgaagaa agtcatgcat ttacaggatg tagaagtgaa gaacgccaca cagtggaagg ataagataaa gagtcagcga atgagaatca gcacggagtt ttcaaagctg cacaacttcc tggttgaaga agaggacctg tttcttcaga gattgaacaa agaagaagaa gagacgaaga agaagctgaa tgagaacacg ttaaaactca atcaaactat cgcttcattg aagaagctca tcttagaggt gggggagaag agccaggctc ccaccctgga gctgcttcag aatccaaaag aagtgttgac caggagtgag atccaggatg tgaactattc tcttgaagct gtaaaggtga agacagtgtg ccagatacca ttgatgaagg aaatgctaaa gcgattccaa gcaactaaaa taaaaacaca aaaacaaaac aggcacaata tgtga. It is sometimes possible for the material contained within the vial of "TRIM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.