Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM27 cdna clone

TRIM27 cDNA Clone

Gene Names
TRIM27; RFP; RNF76
Synonyms
TRIM27; TRIM27 cDNA Clone; TRIM27 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctccgggagtgtggccgagtgcctgcagcaggagaccacctgccccgtgtgcctgcagtacttcgcagagcccatgatgctcgactgcggccataacatctgttgcgcgtgcctcgcccgctgctggggcacggcagagactaacgtgtcgtgcccgcagtgccgggagaccttcccgcagaggcacatgcggcccaaccggcacctggccaacgtgacccaactggtaaagcagctgcgcaccgagcggccgtcggggcccggcggcgagatgggcgtgtgcgagaagcaccgcgagcccctgaagctgtactgcgaggaggaccagatgcccatctgcgtggtgtgcgaccgctcccgcgagcaccgcggccacagcgtgctgccgctcgaggaggcggtggagggcttcaaggagcaaatccagaaccagctcgaccatttaaaaagagtgaaagatttaaagaagagacgtcgggcccagggggaacaggcacgagctgaactcttgagcctaacccagatggagagggagaagattgtttgggagtttgagcagctgtatcactccttaaaggagcatgagtatcgcctcctggcccgccttgaggagctagacttggccatctacaatagcatcaatggtgccatcacccagttctcttgcaacatctcccacctcagcagcctgatcgctcagctagaagagaagcagcagcagcccaccagggagctcctgcaggacattggggacacattgagcagggctgaaagaatcaggattcctgaaccttggatcacacctccagatttgcaagagaaaatccacatttttgcccaaaaatgtctattcttgacggagagtctaaagcagttcacagaaaaaatgcagtcagatatggagaaaatccaagaattaagagaggctcagttatactcagtggacgtgactctggacccagacacggcctaccccagcctgatcctctctgataatctgcggcaagtgcggtacagttacctccaacaggacctgcctgacaaccccgagaggttcaatctgtttccctgtgtcttgggctctccatgcttcatcgccgggagacattattgggaggtagaggtgggagataaagccaagtggaccataggtgtctgtgaagactcagtgtgcagaaaaggtggagtaacctcagccccccagaatggattctgggcagtgtctttgtggtatgggaaagaatattgggctcttacctccccaatgactgccctacccctgcggaccccgctccagcgggtggggattttcttggactatgatgctggtaaggtctccttctacaacgtgacagagaggtgtcacaccttcactttctctcatgctaccttttgtgggcctgtccggccctacttcagtctgagttactcgggagggaaaagtgcagctcctctgatcatctgccccatgagtgggatagatgggttttctggccatgttgggaatcatggtcattccatggagacctccccttga
Sequence Length
1542
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,439 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 27, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 27
NCBI Official Symbol
TRIM27
NCBI Official Synonym Symbols
RFP; RNF76
NCBI Protein Information
zinc finger protein RFP
UniProt Protein Name
Zinc finger protein RFP
Protein Family
UniProt Gene Name
TRIM27
UniProt Synonym Gene Names
RFP; RNF76
UniProt Entry Name
TRI27_HUMAN

NCBI Description

This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM27: Has a transcriptional repressor activity by cooperating with EPC1. Induces apoptosis by activating Jun N-terminal kinase and p38 kinase and also increases caspase-3-like activity independently of mitochondrial events. May function in male germ cell development. Has DNA-binding activity and preferentially bound to double-stranded DNA. E3 ubiquitin-protein ligase that mediates ubiquitination of PIK3C2B and inhibits its activity; mediates the formation of 'Lys-48'-linked polyubiquitin chains; the function inhibits CD4 T-cell activation. Defects in TRIM27 are a cause of thyroid papillary carcinoma (TPC). TPC is a common tumor of the thyroid that typically arises as an irregular, solid or cystic mass from otherwise normal thyroid tissue. Papillary carcinomas are malignant neoplasm characterized by the formation of numerous, irregular, finger-like projections of fibrous stroma that is covered with a surface layer of neoplastic epithelial cells. A chromosomal aberration involving TRIM27/RFP is found in thyroid papillary carcinomas. Translocation t(6;10)(p21.3;q11.2) with RET. The translocation generates TRIM27/RET and delta TRIM27/RET oncogenes. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oncoprotein; Motility/polarity/chemotaxis; Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 6p22

Cellular Component: cytoplasm; endosome; integral to plasma membrane; membrane; nuclear membrane; nucleoplasm; nucleus; retromer complex

Molecular Function: identical protein binding; metal ion binding; nucleic acid binding; protein binding; transmembrane receptor protein tyrosine kinase activity; ubiquitin-protein ligase activity

Biological Process: cell proliferation; innate immune response; negative regulation of adaptive immune response; negative regulation of gene expression, epigenetic; negative regulation of protein kinase activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of tumor necrosis factor production; negative regulation of viral transcription; positive regulation of transcription factor activity; retrograde transport, endosome to Golgi; spermatogenesis

Research Articles on TRIM27

Similar Products

Product Notes

The TRIM27 trim27 (Catalog #AAA1276189) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctccg ggagtgtggc cgagtgcctg cagcaggaga ccacctgccc cgtgtgcctg cagtacttcg cagagcccat gatgctcgac tgcggccata acatctgttg cgcgtgcctc gcccgctgct ggggcacggc agagactaac gtgtcgtgcc cgcagtgccg ggagaccttc ccgcagaggc acatgcggcc caaccggcac ctggccaacg tgacccaact ggtaaagcag ctgcgcaccg agcggccgtc ggggcccggc ggcgagatgg gcgtgtgcga gaagcaccgc gagcccctga agctgtactg cgaggaggac cagatgccca tctgcgtggt gtgcgaccgc tcccgcgagc accgcggcca cagcgtgctg ccgctcgagg aggcggtgga gggcttcaag gagcaaatcc agaaccagct cgaccattta aaaagagtga aagatttaaa gaagagacgt cgggcccagg gggaacaggc acgagctgaa ctcttgagcc taacccagat ggagagggag aagattgttt gggagtttga gcagctgtat cactccttaa aggagcatga gtatcgcctc ctggcccgcc ttgaggagct agacttggcc atctacaata gcatcaatgg tgccatcacc cagttctctt gcaacatctc ccacctcagc agcctgatcg ctcagctaga agagaagcag cagcagccca ccagggagct cctgcaggac attggggaca cattgagcag ggctgaaaga atcaggattc ctgaaccttg gatcacacct ccagatttgc aagagaaaat ccacattttt gcccaaaaat gtctattctt gacggagagt ctaaagcagt tcacagaaaa aatgcagtca gatatggaga aaatccaaga attaagagag gctcagttat actcagtgga cgtgactctg gacccagaca cggcctaccc cagcctgatc ctctctgata atctgcggca agtgcggtac agttacctcc aacaggacct gcctgacaac cccgagaggt tcaatctgtt tccctgtgtc ttgggctctc catgcttcat cgccgggaga cattattggg aggtagaggt gggagataaa gccaagtgga ccataggtgt ctgtgaagac tcagtgtgca gaaaaggtgg agtaacctca gccccccaga atggattctg ggcagtgtct ttgtggtatg ggaaagaata ttgggctctt acctccccaa tgactgccct acccctgcgg accccgctcc agcgggtggg gattttcttg gactatgatg ctggtaaggt ctccttctac aacgtgacag agaggtgtca caccttcact ttctctcatg ctaccttttg tgggcctgtc cggccctact tcagtctgag ttactcggga gggaaaagtg cagctcctct gatcatctgc cccatgagtg ggatagatgg gttttctggc catgttggga atcatggtca ttccatggag acctcccctt ga. It is sometimes possible for the material contained within the vial of "TRIM27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.