TRIM2 cdna clone
TRIM2 cDNA Clone
Gene Names
TRIM2; CMT2R; RNF86
Synonyms
TRIM2; TRIM2 cDNA Clone; TRIM2 cdna clone
Sequence
atggccagtgaaggcaccaacatcccaagtcctgtggtgcgccagattgacaagcagtttctgatttgcagtatatgcctggaacggtacaagaatcccaaggttctcccctgtctgcacactttctgcgagaggtgcctgcagaactacattcctgcccacagtttaaccctctcctgcccagtgtgccgccagacctccatcctgcccgagaaaggggtggccgcgctccagaacaatttcttcatcacaaacctgatggacgtgctgcagcgaactccaggcagcaacgctgaggagtcttccatcctggagacagtcactgctgtggctgcgggaaagcctctctcttgcccaaaccacgatgggaatgtgatggaattttactgccagtcctgtgagactgccatgtgtcgggagtgcacggagggggagcacgcagagcaccccacagttccactcaaggatgtggtggaacagcacaaggcctcgctccaggtccagctggatgctgtcaacaaaaggctcccagaaatagattctgctcttcagttcatctctgaaatcattcatcagttaaccaaccaaaaggccagcatcgtggatgacattcattccacctttgatgagctccagaagactttaaatgtgcgcaagagtgtgctgcttatggaattggaggtcaactatggcctcaaacacaaagtcctccagtcgcagctggatactctgctccaggggcaggagagcattaagagctgcagcaacttcacagcgcaggccctcaaccatggcacggagaccgaggtcctactggtgaagaagcagatgagcgagaagctgaacgagctggccgaccaggacttccccttgcacccgcgggagaacgaccagctggatttcatcgtggaaaccgaggggctgaagaagtccatccacaacctcgggacgatcttaaccaccaacgccgttgcctcagagacagtggccacgggcgaggggctgcggcagaccatcatcgggcagcccatgtccgtcaccatcaccaccaaggacaaagacggtgagctgtgcaaaaccggcaacgcctacctcaccgccgaactgagcacccccgacgggagcgtggcagacggggagatcctggacaacaagaacggcacctatgagtttttgtacactgtccagaaggaaggggactttaccctgtctctgagactctatgaccagcacatccgaggcagcccgtttaagctgaaagtgatccgatccgctgatgtgtctcccaccacagaaggcgtgaagaggcgcgttaagtccccggggagcggccacgtcaagcagaaagctgtgaaaagacccgcaagcatgtacagcactggaaaacgaaaagagaatcccatcgaagacgatttgatctttcgagtgggtaccaaaggaagaaataaaggagagtttacaaatcttcagggggtagctgcatctacaaatggaaagatattaattgcagacagtaacaaccaatgtgtgcagatattttccaatgatggccagttcaaaagtcgttttggcatacggggacgctctccggggcagctgcagcggcccacaggagtggctgtacatcccagtggggacataatcattgccgattatgataataaatgggtcagcattttctcctccgatgggaaatttaagacaaaaattggatcaggaaagctgatgggacccaaaggagtttctgtggaccgcaatgggcacattattgttgtggacaacaaggcgtgctgcgtgtttatcttccagccaaacgggaaaatagtcaccaggtttggtagccgaggaaatggggacaggcagtttgcaggtccccattttgcagctgtaaatagcaataatgagattattattacagatttccataatcattctgtcaaggtgtttaatcaggaaggagaattcatgttgaagtttggctcaaatggagaaggaaatgggcagtttaatgctccaacaggtgtagcagtggattcaaatggaaacatcattgtggccgactggggaaacagcaggatccaggtttttgatgggagtggatcatttttgtcctacattaacacatctgctgacccactctatggcccccaaggcctggccctaacttcagatggtcatgttgtggttgcagactctggaaatcactgtttcaaagtctatcgatacttacagtaa
Sequence Length
2235
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
84,545 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 2, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 2
NCBI Official Symbol
TRIM2
NCBI Official Synonym Symbols
CMT2R; RNF86
NCBI Protein Information
tripartite motif-containing protein 2
UniProt Protein Name
Tripartite motif-containing protein 2
Protein Family
UniProt Gene Name
TRIM2
UniProt Synonym Gene Names
KIAA0517; RNF86
UniProt Entry Name
TRIM2_HUMAN
NCBI Description
The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Uniprot Description
TRIM2: UBE2D1-dependent E3 ubiquitin-protein ligase that mediates the ubiquitination of NEFL and of phosphorylated BCL2L11. Plays a neuroprotective function. May play a role in neuronal rapid ischemic tolerance. Belongs to the TRIM/RBCC family.
Protein type: Ubiquitin ligase; Ligase; Ubiquitin conjugating system; EC 6.3.2.-
Chromosomal Location of Human Ortholog: 4q31.3
Cellular Component: cytoplasm
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: regulation of neuron apoptosis
Disease: Charcot-marie-tooth Disease, Axonal, Type 2r
Research Articles on TRIM2
Similar Products
Product Notes
The TRIM2 trim2 (Catalog #AAA1271325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagtg aaggcaccaa catcccaagt cctgtggtgc gccagattga caagcagttt ctgatttgca gtatatgcct ggaacggtac aagaatccca aggttctccc ctgtctgcac actttctgcg agaggtgcct gcagaactac attcctgccc acagtttaac cctctcctgc ccagtgtgcc gccagacctc catcctgccc gagaaagggg tggccgcgct ccagaacaat ttcttcatca caaacctgat ggacgtgctg cagcgaactc caggcagcaa cgctgaggag tcttccatcc tggagacagt cactgctgtg gctgcgggaa agcctctctc ttgcccaaac cacgatggga atgtgatgga attttactgc cagtcctgtg agactgccat gtgtcgggag tgcacggagg gggagcacgc agagcacccc acagttccac tcaaggatgt ggtggaacag cacaaggcct cgctccaggt ccagctggat gctgtcaaca aaaggctccc agaaatagat tctgctcttc agttcatctc tgaaatcatt catcagttaa ccaaccaaaa ggccagcatc gtggatgaca ttcattccac ctttgatgag ctccagaaga ctttaaatgt gcgcaagagt gtgctgctta tggaattgga ggtcaactat ggcctcaaac acaaagtcct ccagtcgcag ctggatactc tgctccaggg gcaggagagc attaagagct gcagcaactt cacagcgcag gccctcaacc atggcacgga gaccgaggtc ctactggtga agaagcagat gagcgagaag ctgaacgagc tggccgacca ggacttcccc ttgcacccgc gggagaacga ccagctggat ttcatcgtgg aaaccgaggg gctgaagaag tccatccaca acctcgggac gatcttaacc accaacgccg ttgcctcaga gacagtggcc acgggcgagg ggctgcggca gaccatcatc gggcagccca tgtccgtcac catcaccacc aaggacaaag acggtgagct gtgcaaaacc ggcaacgcct acctcaccgc cgaactgagc acccccgacg ggagcgtggc agacggggag atcctggaca acaagaacgg cacctatgag tttttgtaca ctgtccagaa ggaaggggac tttaccctgt ctctgagact ctatgaccag cacatccgag gcagcccgtt taagctgaaa gtgatccgat ccgctgatgt gtctcccacc acagaaggcg tgaagaggcg cgttaagtcc ccggggagcg gccacgtcaa gcagaaagct gtgaaaagac ccgcaagcat gtacagcact ggaaaacgaa aagagaatcc catcgaagac gatttgatct ttcgagtggg taccaaagga agaaataaag gagagtttac aaatcttcag ggggtagctg catctacaaa tggaaagata ttaattgcag acagtaacaa ccaatgtgtg cagatatttt ccaatgatgg ccagttcaaa agtcgttttg gcatacgggg acgctctccg gggcagctgc agcggcccac aggagtggct gtacatccca gtggggacat aatcattgcc gattatgata ataaatgggt cagcattttc tcctccgatg ggaaatttaa gacaaaaatt ggatcaggaa agctgatggg acccaaagga gtttctgtgg accgcaatgg gcacattatt gttgtggaca acaaggcgtg ctgcgtgttt atcttccagc caaacgggaa aatagtcacc aggtttggta gccgaggaaa tggggacagg cagtttgcag gtccccattt tgcagctgta aatagcaata atgagattat tattacagat ttccataatc attctgtcaa ggtgtttaat caggaaggag aattcatgtt gaagtttggc tcaaatggag aaggaaatgg gcagtttaat gctccaacag gtgtagcagt ggattcaaat ggaaacatca ttgtggccga ctggggaaac agcaggatcc aggtttttga tgggagtgga tcatttttgt cctacattaa cacatctgct gacccactct atggccccca aggcctggcc ctaacttcag atggtcatgt tgtggttgca gactctggaa atcactgttt caaagtctat cgatacttac agtaa. It is sometimes possible for the material contained within the vial of "TRIM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
