Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM11 cdna clone

TRIM11 cDNA Clone

Gene Names
TRIM11; BIA1; RNF92
Synonyms
TRIM11; TRIM11 cDNA Clone; TRIM11 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctgaggaccgtgtgcagggtcccgggactggtagagacactgcggaggtttcgaggggacgtgaccttggacccggacaccgccaaccctgagctgatcctgtctgaagacaggcggagcgtgcagcggggggacctacggcaggccctgccggacagcccagagcgctttgaccccggcccctgcgtgctgggccaggagcgcttcacctcaggccgccactactgggaggtggaggttggggaccgcaccagctgggccctgggggtgtgcagggagaacgtgaacaggaaggagaagggcgagctgtccgcgggcaacggcttctggatcctggtcttcctggggagctattacaattcctcggaacgggccttggctccactccgggacccacccaggcgcgtggggatctttctggactacgaggctggacatctctctttctacagtgccaccgatgggtcactgctattcatctttcccgagatccccttctcggggacgctgcggcccctcttctcacccctgtccagcagcccgaccccgatgactatctgccggccgaaaggtgggtccggggacaccctggctccccagtga
Sequence Length
609
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,646 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 11, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 11
NCBI Official Symbol
TRIM11
NCBI Official Synonym Symbols
BIA1; RNF92
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM11
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM11
UniProt Gene Name
TRIM11
UniProt Synonym Gene Names
RNF92
UniProt Entry Name
TRI11_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM11: E3 ubiquitin-protein ligase that promotes the degradation of insoluble ubiquitinated proteins, including insoluble PAX6, poly-Gln repeat expanded HTT and poly-Ala repeat expanded ARX. Mediates PAX6 ubiquitination leading to proteasomal degradation, thereby modulating cortical neurogenesis. May also inhibit PAX6 transcriptional activity, possibly in part by preventing the binding of PAX6 to its consensus sequences. May contribute to the regulation of the intracellular level of HN (humanin) or HN-containing proteins through the proteasomal degradation pathway. Mediates MED15 ubiquitination leading to proteasomal degradation. May contribute to the innate restriction of retroviruses. Upon overexpression, reduces HIV-1 and murine leukemia virus infectivity, by suppressing viral gene expression. Antiviral activity depends on a functional E3 ubiquitin-protein ligase domain. May regulate TRIM5 turnover via the proteasome pathway, thus counteracting the TRIM5-mediated cross-species restriction of retroviral infection at early stages of the retroviral life cycle. Belongs to the TRIM/RBCC family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 1q42.13

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: innate immune response; negative regulation of viral transcription; negative regulation of virion penetration into host cell; positive regulation of virion penetration into host cell

Research Articles on TRIM11

Similar Products

Product Notes

The TRIM11 trim11 (Catalog #AAA1275134) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctga ggaccgtgtg cagggtcccg ggactggtag agacactgcg gaggtttcga ggggacgtga ccttggaccc ggacaccgcc aaccctgagc tgatcctgtc tgaagacagg cggagcgtgc agcgggggga cctacggcag gccctgccgg acagcccaga gcgctttgac cccggcccct gcgtgctggg ccaggagcgc ttcacctcag gccgccacta ctgggaggtg gaggttgggg accgcaccag ctgggccctg ggggtgtgca gggagaacgt gaacaggaag gagaagggcg agctgtccgc gggcaacggc ttctggatcc tggtcttcct ggggagctat tacaattcct cggaacgggc cttggctcca ctccgggacc cacccaggcg cgtggggatc tttctggact acgaggctgg acatctctct ttctacagtg ccaccgatgg gtcactgcta ttcatctttc ccgagatccc cttctcgggg acgctgcggc ccctcttctc acccctgtcc agcagcccga ccccgatgac tatctgccgg ccgaaaggtg ggtccgggga caccctggct ccccagtga. It is sometimes possible for the material contained within the vial of "TRIM11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.