Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIB2 cdna clone

TRIB2 cDNA Clone

Gene Names
TRIB2; C5FW; TRB2; GS3955
Synonyms
TRIB2; TRIB2 cDNA Clone; TRIB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacatacacaggtctacccccatcacaatagcgagatatgggagatcgcggaacaaaacccaggatttcgaagagttgtcgtctataaggtccgcggagcccagccagagtttcagcccgaacctcggctccccgagcccgcccgagactccgaacttgtcgcattgcgtttcttgtatcgggaaatacttattgttggaacctctggagggagaccacgtttttcgtgccgtgcatctgcacagcggagaggagctggtgtgcaaggtgtttgatatcagctgctaccaggaatccctggcaccgtgcttttgcctgtctgctcatagtaacatcaaccaaatcactgaaattatcctgggtgagaccaaagcctatgtgttctttgagcgaagctatggggacatgcattccttcgtccgcacctgcaagaagctgagagaggaggaggcagccagactgttctaccagattgcctcggcagtggcccactgccatgacggggggctggtgctgcgggacctcaagctgcggaaattcatctttaaggacgaagagaggactcgggtcaagctggaaagcctggaagacgcctacattctgcggggagatgatgattccctctccgacaagcatggctgcccggcttacgtaagcccagagatcttgaacaccagtggcagctactcgggcaaagcagccgacgtgtggagcctgggggtgatgctgtacaccatgttggtggggcggtaccctttccatgacattgaacccagctccctcttcagcaagatccggcgtggccagttcaacattccagagactctgtcgcccaaggccaagtgcctcatccgaagcattctgcgtcgggagccctcagagcggctgacctcgcaggaaattctggaccatccttggttttctacagattttagcgtctcgaattcagcatatggtgctaaggaagtgtctgaccagctggtgccggacgtcaacatggaagagaacttggaccctttctttaactga
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,801 Da
NCBI Official Full Name
Homo sapiens tribbles homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
tribbles pseudokinase 2
NCBI Official Symbol
TRIB2
NCBI Official Synonym Symbols
C5FW; TRB2; GS3955
NCBI Protein Information
tribbles homolog 2
UniProt Protein Name
Tribbles homolog 2
Protein Family
UniProt Gene Name
TRIB2
UniProt Synonym Gene Names
TRB-2
UniProt Entry Name
TRIB2_HUMAN

NCBI Description

This gene encodes one of three members of the Tribbles family. The Tribbles members share a Trb domain, which is homologous to protein serine-threonine kinases, but lacks the active site lysine and probably lacks a catalytic function. The Tribbles proteins interact and modulate the activity of signal transduction pathways in a number of physiological and pathological processes. This Tribbles member induces apoptosis of cells mainly of the hematopoietic origin. It has been identified as a protein up-regulated by inflammatory stimuli in myeloid (THP-1) cells, and also as an oncogene that inactivates the transcription factor C/EBPalpha (CCAAT/enhancer-binding protein alpha) and causes acute myelogenous leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

TRB2: Interacts with MAPK kinases and regulates activation of MAP kinases. Does not display kinase activity. Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family. Tribbles subfamily.

Protein type: Protein kinase, CAMK; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); CAMK group; Trbl family

Chromosomal Location of Human Ortholog: 2p24.3

Cellular Component: cytoplasm; nucleus

Molecular Function: mitogen-activated protein kinase kinase binding; nucleotide binding; protein kinase activity; transcription factor binding; ubiquitin protein ligase binding; ubiquitin-protein ligase regulator activity

Biological Process: negative regulation of fat cell differentiation; negative regulation of interleukin-10 biosynthetic process; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein amino acid phosphorylation; regulation of MAP kinase activity

Research Articles on TRIB2

Similar Products

Product Notes

The TRIB2 trib2 (Catalog #AAA1271418) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacatac acaggtctac ccccatcaca atagcgagat atgggagatc gcggaacaaa acccaggatt tcgaagagtt gtcgtctata aggtccgcgg agcccagcca gagtttcagc ccgaacctcg gctccccgag cccgcccgag actccgaact tgtcgcattg cgtttcttgt atcgggaaat acttattgtt ggaacctctg gagggagacc acgtttttcg tgccgtgcat ctgcacagcg gagaggagct ggtgtgcaag gtgtttgata tcagctgcta ccaggaatcc ctggcaccgt gcttttgcct gtctgctcat agtaacatca accaaatcac tgaaattatc ctgggtgaga ccaaagccta tgtgttcttt gagcgaagct atggggacat gcattccttc gtccgcacct gcaagaagct gagagaggag gaggcagcca gactgttcta ccagattgcc tcggcagtgg cccactgcca tgacgggggg ctggtgctgc gggacctcaa gctgcggaaa ttcatcttta aggacgaaga gaggactcgg gtcaagctgg aaagcctgga agacgcctac attctgcggg gagatgatga ttccctctcc gacaagcatg gctgcccggc ttacgtaagc ccagagatct tgaacaccag tggcagctac tcgggcaaag cagccgacgt gtggagcctg ggggtgatgc tgtacaccat gttggtgggg cggtaccctt tccatgacat tgaacccagc tccctcttca gcaagatccg gcgtggccag ttcaacattc cagagactct gtcgcccaag gccaagtgcc tcatccgaag cattctgcgt cgggagccct cagagcggct gacctcgcag gaaattctgg accatccttg gttttctaca gattttagcg tctcgaattc agcatatggt gctaaggaag tgtctgacca gctggtgccg gacgtcaaca tggaagagaa cttggaccct ttctttaact ga. It is sometimes possible for the material contained within the vial of "TRIB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.