Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

TREX1 cdna clone

TREX1 cDNA Clone

Gene Names
TREX1; CRV; AGS1; DRN3; HERNS
Synonyms
TREX1; TREX1 cDNA Clone; TREX1 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgggccctggagctcgcagacagggcaggattgtgcagggaaggcctgagatgtgcttctgcccaccccctaccccactccctccccttcggatcttaacactgggcactcacacacccaccccatgctcctctccaggctcagcagcaggtacgtacccaaccatgggctcgcaggccctgcccccggggcccatgcagaccctcatctttttcgacatggaggccactggcttgcccttctcccagcccaaggtcacggagctgtgcctgctggctgtccacagatgtgccctggagagcccccccacctctcaggggccacctcccacagttcctccaccaccgcgtgtggtagacaagctctccctgtgtgtggctccggggaaggcctgcagccctgcagccagcgagatcacaggtctgagcacagctgtgctggcagcgcatgggcgtcaatgttttgatgacaacctggccaacctgctcctagccttcctgcggcgccagccacagccctggtgcctggtggcacacaatggtgaccgctacgacttccccctgctccaagcagagctggctatgctgggcctcaccagtgctctggatggtgccttctgtgtggatagcatcactgcgctgaaggccctggagcgagcaagcagcccctcagaacacggcccaaggaagagctacagcctaggcagcatctacactcgcctgtatgggcagtcccctccagactcgcacacggctgagggtgatgtcctggccctgctcagcatctgtcagtggagaccacaggccctgctgcggtgggtggatgctcacgccaggcctttcggcaccatcaggcccatgtatggggtcacagcctctgctaggaccaagccaagaccatctgctgtcacaaccactgcacacctggccacaaccaggaacactagtcccagccttggagagagcaggggtaccaaggatcttcctccagtgaaggaccctggagccctatccagggaggggctgctggccccactgggtctgctggccatcctgaccttggcagtagccacactgtatggactatccctggccacacctggggagtag
Sequence Length
1110
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,212 Da
NCBI Official Full Name
Homo sapiens three prime repair exonuclease 1, mRNA
NCBI Official Synonym Full Names
three prime repair exonuclease 1
NCBI Official Symbol
TREX1
NCBI Official Synonym Symbols
CRV; AGS1; DRN3; HERNS
NCBI Protein Information
three-prime repair exonuclease 1
UniProt Protein Name
Three-prime repair exonuclease 1
UniProt Gene Name
TREX1
UniProt Entry Name
TREX1_HUMAN

NCBI Description

This gene encodes a nuclear protein with 3' exonuclease activity. The encoded protein may play a role in DNA repair and serve as a proofreading function for DNA polymerase. Mutations in this gene result in Aicardi-Goutieres syndrome, chilblain lupus, Cree encephalitis, and other diseases of the immune system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]

Uniprot Description

TREX1: the major 3' DNA exonuclease in mammalian cells. Normally associates with the endoplasmic reticulum (ER). Translocates to the nucleus at S phase after DNA damage by gamma-irradiation or hydroxyurea. Trex1-deficient cells show defective G1/S transition, with single-stranded DNA molecules persisting after S phase and accumulating in the ER. Degrades ssDNA. Prevents chronic checkpoint activation and inappropriate immune activation. Mutations cause Aicardi-Goutieres syndrome, an autoimmune disorder. Trex1a(-/-) mice have autoinflammatory responses. The gene for this protein is either identical to or adjacent to that of ATRIP. Some of the mRNAs that encode TREX1 also encode ATRIP in another reading frame. Three alternatively spliced human isoforms have been reported.

Protein type: EC 3.1.11.2; DNA repair, damage; Cell cycle regulation; Deoxyribonuclease; DNA-binding

Chromosomal Location of Human Ortholog: 3p21.31

Disease: Aicardi-goutieres Syndrome 1; Chilblain Lupus 1; Systemic Lupus Erythematosus; Vasculopathy, Retinal, With Cerebral Leukodystrophy

Research Articles on TREX1

Similar Products

Product Notes

The TREX1 trex1 (Catalog #AAA1276797) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccctg gagctcgcag acagggcagg attgtgcagg gaaggcctga gatgtgcttc tgcccacccc ctaccccact ccctcccctt cggatcttaa cactgggcac tcacacaccc accccatgct cctctccagg ctcagcagca ggtacgtacc caaccatggg ctcgcaggcc ctgcccccgg ggcccatgca gaccctcatc tttttcgaca tggaggccac tggcttgccc ttctcccagc ccaaggtcac ggagctgtgc ctgctggctg tccacagatg tgccctggag agccccccca cctctcaggg gccacctccc acagttcctc caccaccgcg tgtggtagac aagctctccc tgtgtgtggc tccggggaag gcctgcagcc ctgcagccag cgagatcaca ggtctgagca cagctgtgct ggcagcgcat gggcgtcaat gttttgatga caacctggcc aacctgctcc tagccttcct gcggcgccag ccacagccct ggtgcctggt ggcacacaat ggtgaccgct acgacttccc cctgctccaa gcagagctgg ctatgctggg cctcaccagt gctctggatg gtgccttctg tgtggatagc atcactgcgc tgaaggccct ggagcgagca agcagcccct cagaacacgg cccaaggaag agctacagcc taggcagcat ctacactcgc ctgtatgggc agtcccctcc agactcgcac acggctgagg gtgatgtcct ggccctgctc agcatctgtc agtggagacc acaggccctg ctgcggtggg tggatgctca cgccaggcct ttcggcacca tcaggcccat gtatggggtc acagcctctg ctaggaccaa gccaagacca tctgctgtca caaccactgc acacctggcc acaaccagga acactagtcc cagccttgga gagagcaggg gtaccaagga tcttcctcca gtgaaggacc ctggagccct atccagggag gggctgctgg ccccactggg tctgctggcc atcctgacct tggcagtagc cacactgtat ggactatccc tggccacacc tggggagtag. It is sometimes possible for the material contained within the vial of "TREX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual