Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TPO cdna clone

TPO cDNA Clone

Gene Names
TPO; MSA; TPX; TDH2A
Synonyms
TPO; TPO cDNA Clone; TPO cdna clone
Ordering
For Research Use Only!
Sequence
atgagagcgctggctgtgctgtctgtcacgctggttatggcctgcacagaagccttcttccccttcatctcgagagggaaagaactcctttggggaaagcctgaggagtctcgtgtctctagcgtcttggaggaaagcaagcgcctggtggacaccgccatgtacgccacgatgcagagaaacctcaagaaaagaggaatcctttctgcagctcagcttctgtctttttccaaacttcctgagccaacaagcggagtgattgcccgagcagcagagataatggaaacatcaatacaagcgatgaaaagaaaagtcaacctgaaaactcaacaatcacagcatccaacggatgctttatcagaagatctgctgagcatcattgcaaacatgtctggatgtctcccttacatgctgcccccaaaatgcccaaacacttgcctggcgaacaaatacaggcccatcacaggagcttgcaacaacagaaaaatgaaatataagcccgaccattccgaaactgccaactaa
Sequence Length
525
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,063 Da
NCBI Official Full Name
Homo sapiens thyroid peroxidase, mRNA
NCBI Official Synonym Full Names
thyroid peroxidase
NCBI Official Symbol
TPO
NCBI Official Synonym Symbols
MSA; TPX; TDH2A
NCBI Protein Information
thyroid peroxidase
UniProt Protein Name
Thyroid peroxidase
Protein Family
UniProt Gene Name
TPO
UniProt Synonym Gene Names
TPO
UniProt Entry Name
PERT_HUMAN

NCBI Description

This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]

Uniprot Description

TPO: Iodination and coupling of the hormonogenic tyrosines in thyroglobulin to yield the thyroid hormones T(3) and T(4). An alternative splicing in the thyroperoxidase mRNA can cause Graves' disease. Defects in TPO are the cause of thyroid dyshormonogenesis 2A (TDH2A). A disorder due to defective conversion of accumulated iodide to organically bound iodine. The iodide organification defect can be partial or complete. Belongs to the peroxidase family. XPO subfamily. 8 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; Membrane protein, integral; EC 1.11.1.8; Amino Acid Metabolism - tyrosine; Mitochondrial

Chromosomal Location of Human Ortholog: 2p25

Cellular Component: extracellular space; integral to plasma membrane; plasma membrane

Molecular Function: peroxidase activity

Biological Process: embryonic hemopoiesis; thyroid hormone generation

Disease: Thyroid Dyshormonogenesis 2a

Research Articles on TPO

Similar Products

Product Notes

The TPO tpo (Catalog #AAA1275209) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagcgc tggctgtgct gtctgtcacg ctggttatgg cctgcacaga agccttcttc cccttcatct cgagagggaa agaactcctt tggggaaagc ctgaggagtc tcgtgtctct agcgtcttgg aggaaagcaa gcgcctggtg gacaccgcca tgtacgccac gatgcagaga aacctcaaga aaagaggaat cctttctgca gctcagcttc tgtctttttc caaacttcct gagccaacaa gcggagtgat tgcccgagca gcagagataa tggaaacatc aatacaagcg atgaaaagaa aagtcaacct gaaaactcaa caatcacagc atccaacgga tgctttatca gaagatctgc tgagcatcat tgcaaacatg tctggatgtc tcccttacat gctgccccca aaatgcccaa acacttgcct ggcgaacaaa tacaggccca tcacaggagc ttgcaacaac agaaaaatga aatataagcc cgaccattcc gaaactgcca actaa. It is sometimes possible for the material contained within the vial of "TPO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.