Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TPK1 cdna clone

TPK1 cDNA Clone

Gene Names
TPK1; PP20; HTPK1; THMD5
Synonyms
TPK1; TPK1 cDNA Clone; TPK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcatgcctttaccccgttggagcccctgctttccactgggaatttgaagtactgccttgtaattcttaatcagcctttggacaactattttcgtcatctttggaacaaagctcttttaagagcctgtgccgatggaggtgccaaccgcttatatgatatcaccgaaggagagagagaaagctttttgcctgaattcatcaatggagactttgattctattaggcctgaagtcagagaatactatgctactaagggatgtgagctcatttcaactcctgatcaagaccacactgactttactaagtgccttaaaatgctccaaaagaagatagaagaaaaagacttaaaggttgatgtgatcgtgacactgggaggccttgctgggcgttttgaccagattatggcatctgtgaataccttgttccaagcgactcacatcactccttttccaattataataatccaagaggaatcgctgatctacctgctccaaccaggaaagcacaggttgcatgtagacactggaatggagggtgattggtgtggccttattcctgttggacagccttgtagtcaggttacaaccacaggcctcaagtggaacctcacaaatgatgtgcttgcttttggaacattggtcagtacttccaatacctacgacgggtctggtgttgtgactgtggaaactgaccacccactcctctggaccatggccatcaaaagctaa
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,962 Da
NCBI Official Full Name
Homo sapiens thiamin pyrophosphokinase 1, mRNA
NCBI Official Synonym Full Names
thiamin pyrophosphokinase 1
NCBI Official Symbol
TPK1
NCBI Official Synonym Symbols
PP20; HTPK1; THMD5
NCBI Protein Information
thiamin pyrophosphokinase 1
UniProt Protein Name
Thiamin pyrophosphokinase 1
Protein Family
UniProt Gene Name
TPK1
UniProt Synonym Gene Names
hTPK1; PP20
UniProt Entry Name
TPK1_HUMAN

NCBI Description

This gene encodes a protein, that exists as a homodimer, which catalyzes the conversion of thiamine to thiamine pyrophosphate. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

TPK1: Catalyzes the phosphorylation of thiamine to thiamine pyrophosphate. Can also catalyze the phosphorylation of pyrithiamine to pyrithiamine pyrophosphate. Defects in TPK1 are the cause of thiamine metabolism dysfunction syndrome type 5, episodic encephalopathy type (THMD5). An autosomal recessive metabolic disorder due to an inborn error of thiamine metabolism. The phenotype is highly variable, but in general, affected individuals have onset in early childhood of acute encephalopathic episodes associated with increased serum and CSF lactate. These episodes result in progressive neurologic dysfunction manifest as gait disturbances, ataxia, dystonia, and spasticity, which in some cases may result in loss of ability to walk. Cognitive function is usually preserved, although mildly delayed development has been reported. These episodes are usually associated with infection and metabolic decompensation. Some patients may have recovery of some neurologic deficits. Belongs to the thiamine pyrophosphokinase family.

Protein type: EC 2.7.6.2; Kinase, other; Cofactor and Vitamin Metabolism - thiamine

Chromosomal Location of Human Ortholog: 7q34-q35

Cellular Component: cytosol

Molecular Function: thiamin diphosphokinase activity

Biological Process: thiamin and derivative metabolic process; thiamin diphosphate biosynthetic process

Disease: Thiamine Metabolism Dysfunction Syndrome 5 (episodic Encephalopathy Type)

Research Articles on TPK1

Similar Products

Product Notes

The TPK1 tpk1 (Catalog #AAA1272691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcatg cctttacccc gttggagccc ctgctttcca ctgggaattt gaagtactgc cttgtaattc ttaatcagcc tttggacaac tattttcgtc atctttggaa caaagctctt ttaagagcct gtgccgatgg aggtgccaac cgcttatatg atatcaccga aggagagaga gaaagctttt tgcctgaatt catcaatgga gactttgatt ctattaggcc tgaagtcaga gaatactatg ctactaaggg atgtgagctc atttcaactc ctgatcaaga ccacactgac tttactaagt gccttaaaat gctccaaaag aagatagaag aaaaagactt aaaggttgat gtgatcgtga cactgggagg ccttgctggg cgttttgacc agattatggc atctgtgaat accttgttcc aagcgactca catcactcct tttccaatta taataatcca agaggaatcg ctgatctacc tgctccaacc aggaaagcac aggttgcatg tagacactgg aatggagggt gattggtgtg gccttattcc tgttggacag ccttgtagtc aggttacaac cacaggcctc aagtggaacc tcacaaatga tgtgcttgct tttggaacat tggtcagtac ttccaatacc tacgacgggt ctggtgttgt gactgtggaa actgaccacc cactcctctg gaccatggcc atcaaaagct aa. It is sometimes possible for the material contained within the vial of "TPK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.