Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM67 cdna clone

TMEM67 cDNA Clone

Gene Names
TMEM67; MKS3; JBTS6; NPHP11; TNEM67; MECKELIN
Synonyms
TMEM67; TMEM67 cDNA Clone; TMEM67 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtttggtccctcttatccgcccgggccgtgaccgcgttccttctgttgttcctccctcgcttcttacaggcccagaccttctctttccctttccagcagccggagaagtgcgacaacaaccagtactttgatatctccgccctctcgtgtgttccttgtggagctaaccagaggcaagatgcccgaggaacttcatgtgtatgtctaccaggatttcagatgatctctaataatggaggacctgctattatttgtaaaaagtgcccagaaaacatgaaaggtgttacagaagatggctggaactgcatttcttgccctagtgacttaactgccgaaggaaaatgtcactgtcccattggccatattttagtggaaagagacattaatggaacattgttgtctcaagcaacttgtgagctctgtgatggaaatgaaaactcttttatggtagtaaatgctttaggagacaggtgcgtccgatgtgagccaacatttgttaataccagcaggtcctgtgcatgttcagaacctaacattttaacagggggattatgtttcagcagcacagggaattttcctctacgtagaatttcagctgcacgttatggagaagttggcatgtctttaacttcagaatggtttgcaaagtatttgcaatcatcagcagctgcatgttgggtatatgccaatctaacatcttgtcaagctcttggaaatatgtgtgtgatgaacatgaattcttacgactttgccacatttgatgcatgtggactatttcagtttatctttgaaaatactgctggactgagcactgttcattctatttcattttggagacagaatcttccttggctgttttatggagaccagttaggattagcacctcaagtgctcagttctacctctcttcctacaaatttcagttttaaaggagaaaaccagaatacaaaactgaagtttgttgctgcttcctatgatataagaggaaattttctcaagtggcaaactttagaaggaggtgttttacagctttgtccagacacagagacaaggctaaatgctgcttattcatttggaacaacctaccaacaaaattgtgagattcctatctctaagatcttaattgactttcccactcctatattttatgatgtgtaccttgaatatactgatgaaaatcaacatcaatatattttggctgtgcctgtgttaaacctaaatcttcaacataataagatatttgtgaaccaagacagcaactctggaaagtggcttctaactcggcgcattttcttagtggatgcagtaagtggacgagaaaatgacttaggaactcagccaagagtaattcgagttgctactcaaatatcactgagtgtccaccttgtacccaacacaataaatggaaacatctaccctcccttaatcaccattgcctacagtgacattgatatcaaagatgccaacagccagtctgtgaaggtttctttctcagtcacatatgaaatggatcatggagaagcacatgtccagacagatattgctttgggtgtattgggtgggctagctgttttagcatctcttttgaagacagcaggatggaagaggcgcattgggagtcccatgattgatttacagacagttgtgaaattcttggtgtactatgctggtgatctggccaatgttttctttatcatcacagtgggaacaggtctttactggcttattttcttcaaagcacagaagtctgtgtctgttttgctgccaatgccaattcaggaagaacgttttgtcacttatgttggatgtgcctttgctctgaaggcactacaatttttgcataagctcatatcccagattacaatagatgtattctttattgattgggagcgacctaaaggaaaggttcttaaagctgttgaaggtgagggtggtgtacgaagtgccactgttcctgtaagcatatggagaacatattttgtagcaaatgaatggaatgaaattcagactgtgagaaaaattaattcactctttcaagtacttactgtcctcttctttttggaggttgtgggattcaagaacttagcattaatggactcatcttctagtctttctagaaacccacctagctacatagctccttatagctgcattttgagatatgcagtgtctgctgctctttggctagccattggaattatacaggtcgtgttctttgctgtcttttatgagagatttatagaagataaaattcgacagttcgttgatttatgctctatgagtaatatatcagtgtttctgttatcccacaaatgttttggatattacattcatggtagatcagtacatgggcatgcagatactaatatggaagaaatgaatatgaaccttaaaagagaagcggaaaatttgtgtagccagagaggtttggtacccaacacagatggtcagacttttgagattgcaatttctaaccagatgagacaacattatgacagaattcatgagacactaataaggaaaaatggtcctgctagactactgagttcatcagcaagtacttttgagcagagtataaaagcatatcatatgatgaataaatttcttggctccttcattgaccatgttcataaggaaatggattactttataaaagataagttgcttcttgaaagaattcttggaatggaattcatggaaccaatggaaaaaagcatcttttacaatgatgaaggttattctttcagcagtgtcctgtattatggaaatgaagctactcttcttatttttgatctgctgttcttctgtgttgtggatttggcttgccaaaattttattttagcatccttccttacatatctacaacaagagatttttagatatatccgtaatacagtaggacaaaagaatttggcatccaaaacattggtggatcaaagatttttgatttaa
Sequence Length
2958
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
103,590 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 67, mRNA
NCBI Official Synonym Full Names
transmembrane protein 67
NCBI Official Symbol
TMEM67
NCBI Official Synonym Symbols
MKS3; JBTS6; NPHP11; TNEM67; MECKELIN
NCBI Protein Information
meckelin
UniProt Protein Name
Meckelin
Protein Family
UniProt Gene Name
TMEM67
UniProt Synonym Gene Names
MKS3
UniProt Entry Name
MKS3_HUMAN

NCBI Description

The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]

Uniprot Description

TMEM67: a protein localizes to the primary cilium and to the plasma membrane. Involved in centrosome migration to the apical cell surface during early ciliogenesis. Required for ciliary structure and function, including a role in regulating length and appropriate number through modulating centrosome duplication. Required for cell branching morphology. Essential for endoplasmic reticulum-associated degradation (ERAD) of surfactant protein C (SFTPC). Ciliary dysfunction leads to a broad spectrum of disorders, collectively termed ciliopathies. Defects in this protein are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). Overlapping clinical features include retinal degeneration, renal cystic disease, skeletal abnormalities, fibrosis of various organ, and a complex range of anatomical and functional defects of the central and peripheral nervous system. Interacts with DNAJB9, DNAJC10, MKS1 and mutated SFTPC. Interacts with SYNE2 during the early establishment of cell polarity.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q22.1

Cellular Component: centrosome; cytoplasmic vesicle membrane; endoplasmic reticulum membrane

Molecular Function: filamin binding; protein binding; unfolded protein binding

Biological Process: cilium biogenesis; ER-associated protein catabolic process

Disease: Bardet-biedl Syndrome 1; Bardet-biedl Syndrome 14; Coach Syndrome; Joubert Syndrome 6; Meckel Syndrome, Type 3; Nephronophthisis 11

Research Articles on TMEM67

Similar Products

Product Notes

The TMEM67 tmem67 (Catalog #AAA1266461) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggttt ggtccctctt atccgcccgg gccgtgaccg cgttccttct gttgttcctc cctcgcttct tacaggccca gaccttctct ttccctttcc agcagccgga gaagtgcgac aacaaccagt actttgatat ctccgccctc tcgtgtgttc cttgtggagc taaccagagg caagatgccc gaggaacttc atgtgtatgt ctaccaggat ttcagatgat ctctaataat ggaggacctg ctattatttg taaaaagtgc ccagaaaaca tgaaaggtgt tacagaagat ggctggaact gcatttcttg ccctagtgac ttaactgccg aaggaaaatg tcactgtccc attggccata ttttagtgga aagagacatt aatggaacat tgttgtctca agcaacttgt gagctctgtg atggaaatga aaactctttt atggtagtaa atgctttagg agacaggtgc gtccgatgtg agccaacatt tgttaatacc agcaggtcct gtgcatgttc agaacctaac attttaacag ggggattatg tttcagcagc acagggaatt ttcctctacg tagaatttca gctgcacgtt atggagaagt tggcatgtct ttaacttcag aatggtttgc aaagtatttg caatcatcag cagctgcatg ttgggtatat gccaatctaa catcttgtca agctcttgga aatatgtgtg tgatgaacat gaattcttac gactttgcca catttgatgc atgtggacta tttcagttta tctttgaaaa tactgctgga ctgagcactg ttcattctat ttcattttgg agacagaatc ttccttggct gttttatgga gaccagttag gattagcacc tcaagtgctc agttctacct ctcttcctac aaatttcagt tttaaaggag aaaaccagaa tacaaaactg aagtttgttg ctgcttccta tgatataaga ggaaattttc tcaagtggca aactttagaa ggaggtgttt tacagctttg tccagacaca gagacaaggc taaatgctgc ttattcattt ggaacaacct accaacaaaa ttgtgagatt cctatctcta agatcttaat tgactttccc actcctatat tttatgatgt gtaccttgaa tatactgatg aaaatcaaca tcaatatatt ttggctgtgc ctgtgttaaa cctaaatctt caacataata agatatttgt gaaccaagac agcaactctg gaaagtggct tctaactcgg cgcattttct tagtggatgc agtaagtgga cgagaaaatg acttaggaac tcagccaaga gtaattcgag ttgctactca aatatcactg agtgtccacc ttgtacccaa cacaataaat ggaaacatct accctccctt aatcaccatt gcctacagtg acattgatat caaagatgcc aacagccagt ctgtgaaggt ttctttctca gtcacatatg aaatggatca tggagaagca catgtccaga cagatattgc tttgggtgta ttgggtgggc tagctgtttt agcatctctt ttgaagacag caggatggaa gaggcgcatt gggagtccca tgattgattt acagacagtt gtgaaattct tggtgtacta tgctggtgat ctggccaatg ttttctttat catcacagtg ggaacaggtc tttactggct tattttcttc aaagcacaga agtctgtgtc tgttttgctg ccaatgccaa ttcaggaaga acgttttgtc acttatgttg gatgtgcctt tgctctgaag gcactacaat ttttgcataa gctcatatcc cagattacaa tagatgtatt ctttattgat tgggagcgac ctaaaggaaa ggttcttaaa gctgttgaag gtgagggtgg tgtacgaagt gccactgttc ctgtaagcat atggagaaca tattttgtag caaatgaatg gaatgaaatt cagactgtga gaaaaattaa ttcactcttt caagtactta ctgtcctctt ctttttggag gttgtgggat tcaagaactt agcattaatg gactcatctt ctagtctttc tagaaaccca cctagctaca tagctcctta tagctgcatt ttgagatatg cagtgtctgc tgctctttgg ctagccattg gaattataca ggtcgtgttc tttgctgtct tttatgagag atttatagaa gataaaattc gacagttcgt tgatttatgc tctatgagta atatatcagt gtttctgtta tcccacaaat gttttggata ttacattcat ggtagatcag tacatgggca tgcagatact aatatggaag aaatgaatat gaaccttaaa agagaagcgg aaaatttgtg tagccagaga ggtttggtac ccaacacaga tggtcagact tttgagattg caatttctaa ccagatgaga caacattatg acagaattca tgagacacta ataaggaaaa atggtcctgc tagactactg agttcatcag caagtacttt tgagcagagt ataaaagcat atcatatgat gaataaattt cttggctcct tcattgacca tgttcataag gaaatggatt actttataaa agataagttg cttcttgaaa gaattcttgg aatggaattc atggaaccaa tggaaaaaag catcttttac aatgatgaag gttattcttt cagcagtgtc ctgtattatg gaaatgaagc tactcttctt atttttgatc tgctgttctt ctgtgttgtg gatttggctt gccaaaattt tattttagca tccttcctta catatctaca acaagagatt tttagatata tccgtaatac agtaggacaa aagaatttgg catccaaaac attggtggat caaagatttt tgatttaa. It is sometimes possible for the material contained within the vial of "TMEM67, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.