Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM59 cdna clone

TMEM59 cDNA Clone

Gene Names
TMEM59; DCF1; C1orf8; PRO195; UNQ169; HSPC001
Synonyms
TMEM59; TMEM59 cDNA Clone; TMEM59 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgccgaaggggagcctctgggtgaggacccaactggggctcccgccgctgctgctgctgaccatggccttggccggaggttcggggaccgcttcggctgaagcatttgactcggtcttgggtgatacggcgtcttgccaccgggcctgtcagttgacctaccccttgcacacctaccctaaggaagaggagttgtacgcatgtcagagaggttgcaggctgttttcaatttgtcagtttgtggatgatggaattgacttaaatcgaactaaattggaatgtgaatctgcatgtacagaagcatattcccaatctgatgagcaatatgcttgccatcttggttgccagaatcagctgccattcgctgaactgagacaagaacaacttatgtccctgatgccaaaaatgcacctactctttcctctaactctggtgaggtcattctggagtgacatgatggactccgcacagagcttcataacctcttcatggactttttatcttcaagccgatgacggaaaaatagttatattccagtctaagccagaaatccagtacgcaccacatttggagcaggagcctacaaatttgagagaatcatctctaagcaaaatgtcctcagatctgcaaatgagaaattcacaagcgcacaggaattttcttgaagatggagaaagtgatggctttttaagatgcctctctcttaactctgggtggattttaactacaactcttgtcctctcggtgatggtattgctttggatttgttgtgcaactgttgctacagctgtggagcagtatgttccctctgagaagctgagtatctatggtgacttggagtttatgaatgaacaaaagctaaacagatatccagcttcttctcttgtggttgttagatctaaaactgaagatcatgaagaagcagggcctctacctacaaaagtgaatcttgctcattctgaaatttaa
Sequence Length
975
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,223 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 59, mRNA
NCBI Official Synonym Full Names
transmembrane protein 59
NCBI Official Symbol
TMEM59
NCBI Official Synonym Symbols
DCF1; C1orf8; PRO195; UNQ169; HSPC001
NCBI Protein Information
transmembrane protein 59
UniProt Protein Name
Transmembrane protein 59
Protein Family
UniProt Gene Name
TMEM59
UniProt Synonym Gene Names
C1orf8
UniProt Entry Name
TMM59_HUMAN

NCBI Description

This gene encodes a protein shown to regulate autophagy in response to bacterial infection. This protein may also regulate the retention of amyloid precursor protein (APP) in the Golgi apparatus through its control of APP glycosylation. Overexpression of this protein has been found to promote apoptosis in a glioma cell line. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Uniprot Description

TMEM59: Modulates the O-glycosylation and complex N- glycosylation steps occurring during the Golgi maturation of several proteins such as APP, BACE1, SEAP or PRNP. Inhibits APP transport to the cell surface and further shedding. Belongs to the TMEM59 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p32.3

Cellular Component: Golgi cis cisterna; Golgi medial cisterna; Golgi trans cisterna; late endosome; lysosome

Molecular Function: protein binding

Biological Process: positive regulation of autophagy

Research Articles on TMEM59

Similar Products

Product Notes

The TMEM59 tmem59 (Catalog #AAA1266626) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc cgaaggggag cctctgggtg aggacccaac tggggctccc gccgctgctg ctgctgacca tggccttggc cggaggttcg gggaccgctt cggctgaagc atttgactcg gtcttgggtg atacggcgtc ttgccaccgg gcctgtcagt tgacctaccc cttgcacacc taccctaagg aagaggagtt gtacgcatgt cagagaggtt gcaggctgtt ttcaatttgt cagtttgtgg atgatggaat tgacttaaat cgaactaaat tggaatgtga atctgcatgt acagaagcat attcccaatc tgatgagcaa tatgcttgcc atcttggttg ccagaatcag ctgccattcg ctgaactgag acaagaacaa cttatgtccc tgatgccaaa aatgcaccta ctctttcctc taactctggt gaggtcattc tggagtgaca tgatggactc cgcacagagc ttcataacct cttcatggac tttttatctt caagccgatg acggaaaaat agttatattc cagtctaagc cagaaatcca gtacgcacca catttggagc aggagcctac aaatttgaga gaatcatctc taagcaaaat gtcctcagat ctgcaaatga gaaattcaca agcgcacagg aattttcttg aagatggaga aagtgatggc tttttaagat gcctctctct taactctggg tggattttaa ctacaactct tgtcctctcg gtgatggtat tgctttggat ttgttgtgca actgttgcta cagctgtgga gcagtatgtt ccctctgaga agctgagtat ctatggtgac ttggagttta tgaatgaaca aaagctaaac agatatccag cttcttctct tgtggttgtt agatctaaaa ctgaagatca tgaagaagca gggcctctac ctacaaaagt gaatcttgct cattctgaaa tttaa. It is sometimes possible for the material contained within the vial of "TMEM59, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.