TMEM147 cdna clone
TMEM147 cDNA Clone
Gene Names
TMEM147; NIFIE14
Synonyms
TMEM147; TMEM147 cDNA Clone; TMEM147 cdna clone
Sequence
atgaccctgtttcacttcgggaactgcttcgctcttgcctacttcccctacttcatcacctacaagtgcagcggcctgtccgagtacaacgccttctggaaatgcgtccaggctggagtcacctacctctttgtccaactctgcaagatgctgttcttggccactttctttcccacctgggaaggcggcatctatgacttcattggggagttcatgaaggccagcgtggatgtggcagacctgataggtctaaaccttgtcatgtcccggaatgccggcaagggagagtacaagatcatggttgctgccctgggctgggccactgctgagcttattatgtcccgctgcattcccctatgggtcggagcccggggcattgagtttgactggaagtacatccagatgagcatagactccaacatcagtctggtccattacatcgtcgcgtctgctcaggtctggatgataacacgctatgatctgtaccacaccttccggccagctgtcctcctgctgatgttcctcagtgtctacaaggcctttgttatggagaccttcgtccacctctgctcgctgggcagttgggcagctctactggcccgagcagtggtaacggggctgctggccctcagcactttggccctgtatgtcgccgttgtcaatgtgcactcctag
Sequence Length
675
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,543 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 147, mRNA
NCBI Official Synonym Full Names
transmembrane protein 147
NCBI Official Symbol
TMEM147
NCBI Official Synonym Symbols
NIFIE14
NCBI Protein Information
transmembrane protein 147
UniProt Protein Name
Transmembrane protein 147
Protein Family
UniProt Gene Name
TMEM147
UniProt Entry Name
TM147_HUMAN
Uniprot Description
TMEM147: Forms a complex with NCLN and NOMO2, resulting in a stabilization of the 3 proteins, which are otherwise quickly degraded by the proteasome. Due to the strong similarity between NOMO1, NOMO2 and NOMO3, probably also interacts with NOMO1 and NOMO3.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 19q13.1
Cellular Component: endoplasmic reticulum membrane
Molecular Function: protein binding
Biological Process: protein destabilization
Research Articles on TMEM147
Similar Products
Product Notes
The TMEM147 tmem147 (Catalog #AAA1269824) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccctgt ttcacttcgg gaactgcttc gctcttgcct acttccccta cttcatcacc tacaagtgca gcggcctgtc cgagtacaac gccttctgga aatgcgtcca ggctggagtc acctacctct ttgtccaact ctgcaagatg ctgttcttgg ccactttctt tcccacctgg gaaggcggca tctatgactt cattggggag ttcatgaagg ccagcgtgga tgtggcagac ctgataggtc taaaccttgt catgtcccgg aatgccggca agggagagta caagatcatg gttgctgccc tgggctgggc cactgctgag cttattatgt cccgctgcat tcccctatgg gtcggagccc ggggcattga gtttgactgg aagtacatcc agatgagcat agactccaac atcagtctgg tccattacat cgtcgcgtct gctcaggtct ggatgataac acgctatgat ctgtaccaca ccttccggcc agctgtcctc ctgctgatgt tcctcagtgt ctacaaggcc tttgttatgg agaccttcgt ccacctctgc tcgctgggca gttgggcagc tctactggcc cgagcagtgg taacggggct gctggccctc agcactttgg ccctgtatgt cgccgttgtc aatgtgcact cctag. It is sometimes possible for the material contained within the vial of "TMEM147, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
