TMEM110 cdna clone
TMEM110 cDNA Clone
Gene Names
TMEM110; STIMATE
Synonyms
TMEM110; TMEM110 cDNA Clone; TMEM110 cdna clone
Sequence
atgcagggccccgccgggaacgcgagccggggactgccaggcgggccgccctccacagtcgcgtccggggcgggccgctgcgagagcggcgcgctcatgcacagcttcggcatcttcctgcaggggctgctcggcgtcgtggccttcagcacgttaatgctcaaacgcttcagagaaccaaagcatgaaagacgtccgtggaggatatggtttttagacacttccaaacaagccataggaatgctgttcatccactttgcaaatgtatacctagcagatctcactgaagaggacccttgttcactgtacctcatcaacttcctcctggacgccactgtgggcatgctgctcatctacgtgggggtgcgcgccgtcagcgtcctggtagagtggcagcagtgggagtccctgcgcttcggcgaatatggagaccctctgcagtgtggagcctgggtcgggcagtgcgctctttacatcgtgatcatgatttttgaaaagtctgtcgtcttcatcgtcctcctaatacttcagtggaaaaaggtggccctgttgaatcccattgaaaacccagacttgaagctggccatcgtcatgctgatcgtccccttctttgtcaacgctttgatgttttgggtagtggacaatttcctcatgagaaaggggaagacgaaagctaagctagaagaaaggggagccaaccaggactcgaggaatgggagcaaggtccgctaccggagggccgcatcccacgaggagtctgagtctgagatcctgatctcagcggatgatgagatggaggagtccgacgtggaggaggacctccgcagactgacccccctcaagcctgtgaagaaaaagaagcaccgctttgggctacccgtatga
Sequence Length
885
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,187 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 110, mRNA
NCBI Official Synonym Full Names
transmembrane protein 110
NCBI Official Symbol
TMEM110
NCBI Official Synonym Symbols
STIMATE
NCBI Protein Information
store-operated calcium entry regulator STIMATE
UniProt Protein Name
Store-operated calcium entry regulator STIMATE
Protein Family
UniProt Gene Name
TMEM110
UniProt Synonym Gene Names
STIMATE
UniProt Entry Name
STIMA_HUMAN
Uniprot Description
TMEM110: Acts as a regulator of store-operated Ca(2+) entry (SOCE) at junctional sites that connect the cell membrane and endoplasmic reticulum. SOCE is a Ca(2+) influx following depletion of intracellular Ca(2+) stores. Acts by interacting with STIM1, promoting STIM1 conformational switch. {ECO:0000269|PubMed:26322679}. Belongs to the STIMATE family. {ECO:0000305}. Homooligomer (PubMed:26322679). Interacts with STIM1 (PubMed:26322679). {ECO:0000269|PubMed:26322679}
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 3p21.1
Cellular Component: endoplasmic reticulum membrane
Molecular Function: calcium channel regulator activity; protein binding
Biological Process: activation of store-operated calcium channel activity; positive regulation of NFAT protein import into nucleus
Research Articles on TMEM110
Similar Products
Product Notes
The TMEM110 tmem110 (Catalog #AAA1267718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagggcc ccgccgggaa cgcgagccgg ggactgccag gcgggccgcc ctccacagtc gcgtccgggg cgggccgctg cgagagcggc gcgctcatgc acagcttcgg catcttcctg caggggctgc tcggcgtcgt ggccttcagc acgttaatgc tcaaacgctt cagagaacca aagcatgaaa gacgtccgtg gaggatatgg tttttagaca cttccaaaca agccatagga atgctgttca tccactttgc aaatgtatac ctagcagatc tcactgaaga ggacccttgt tcactgtacc tcatcaactt cctcctggac gccactgtgg gcatgctgct catctacgtg ggggtgcgcg ccgtcagcgt cctggtagag tggcagcagt gggagtccct gcgcttcggc gaatatggag accctctgca gtgtggagcc tgggtcgggc agtgcgctct ttacatcgtg atcatgattt ttgaaaagtc tgtcgtcttc atcgtcctcc taatacttca gtggaaaaag gtggccctgt tgaatcccat tgaaaaccca gacttgaagc tggccatcgt catgctgatc gtccccttct ttgtcaacgc tttgatgttt tgggtagtgg acaatttcct catgagaaag gggaagacga aagctaagct agaagaaagg ggagccaacc aggactcgag gaatgggagc aaggtccgct accggagggc cgcatcccac gaggagtctg agtctgagat cctgatctca gcggatgatg agatggagga gtccgacgtg gaggaggacc tccgcagact gacccccctc aagcctgtga agaaaaagaa gcaccgcttt gggctacccg tatga. It is sometimes possible for the material contained within the vial of "TMEM110, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
