TMCO3 cdna clone
TMCO3 cDNA Clone
Gene Names
TMCO3; C13orf11
Synonyms
TMCO3; TMCO3 cDNA Clone; TMCO3 cdna clone
Sequence
atgaaggtgttgggaagaagcttcttctgggtgctgtttcccgtccttccctgggcggtgcaggctgtggagcacgaggaggtggcgcagcgtgtgatcaaactgcaccgcgggcgaggggtggctgccatgcagagccggcagtgggtccgggacagctgcaggaagctctcagggcttctccgccagaagaatgcagttctgaacaaactgaaaactgcaattggagcagtggagaaagacgtgggcctgtcggatgaagagaaactgtttcaggtgcacacgtttgaaattttccagaaagagctgaatgaaagtgaaaattccgttttccaagctgtctacggactgcagagagccctgcagggggattacaaagatgtcgtgaacatgaaggagagcagccggcagcgcctggaggccctgagagaggctgcaataaaggaagaaacagaatatatggaacttctggcagcagaaaaacatcaagttgaagcccttaaaaatatgcaacatcaaaaccaaagtttatccatgcttgacgagattcttgaagatgtaagaaaggcagcggatcgtctggaggaagagatagaggaacatgcttttgacgacaataaatcagtcaagggggtcaattttgaggcagttctgagggtggaggaagaagaggccaattctaagcaaaatataacaaaacgagaagtggaggatgacttgggtcttagcatgctgattgactcccagaacaaccagtatattttgaccaagcccagagattcaaccatcccacgtgcagatcaccactttataaaggacattgttaccataggaatgctgtccttgccttgtggctggctatgtacagccataggattgcctacaatgtttggttatattatttgtggtgtacttctgggaccttcaggactaaatagtattaagtctattgtgcaagtggagacattaggagaatttggggtgttttttactctttttcttgttggcttagaattttctccagaaaagctaagaaaggtgtggaagatttccttacaagggccgtgttacatgacactgttaatgattgcatttggcttgctgtgggggcatctcttgcggatcaaacccacgcagagcgtcttcatttccacgtgtctgtccttgtcaagcacacccctcgtgtccaggttcctcatgggcagtgctcggggtgacaaagaaggcaacagaacagccctctag
Sequence Length
1245
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,844 Da
NCBI Official Full Name
Homo sapiens transmembrane and coiled-coil domains 3, mRNA
NCBI Official Synonym Full Names
transmembrane and coiled-coil domains 3
NCBI Official Symbol
TMCO3
NCBI Official Synonym Symbols
C13orf11
NCBI Protein Information
transmembrane and coiled-coil domain-containing protein 3
UniProt Protein Name
Transmembrane and coiled-coil domain-containing protein 3
Protein Family
UniProt Gene Name
TMCO3
UniProt Synonym Gene Names
C13orf11
UniProt Entry Name
TMCO3_HUMAN
Uniprot Description
TMCO3: Probable Na(+)/H(+) antiporter. Belongs to the monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 13q34
Similar Products
Product Notes
The TMCO3 tmco3 (Catalog #AAA1270249) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtgt tgggaagaag cttcttctgg gtgctgtttc ccgtccttcc ctgggcggtg caggctgtgg agcacgagga ggtggcgcag cgtgtgatca aactgcaccg cgggcgaggg gtggctgcca tgcagagccg gcagtgggtc cgggacagct gcaggaagct ctcagggctt ctccgccaga agaatgcagt tctgaacaaa ctgaaaactg caattggagc agtggagaaa gacgtgggcc tgtcggatga agagaaactg tttcaggtgc acacgtttga aattttccag aaagagctga atgaaagtga aaattccgtt ttccaagctg tctacggact gcagagagcc ctgcaggggg attacaaaga tgtcgtgaac atgaaggaga gcagccggca gcgcctggag gccctgagag aggctgcaat aaaggaagaa acagaatata tggaacttct ggcagcagaa aaacatcaag ttgaagccct taaaaatatg caacatcaaa accaaagttt atccatgctt gacgagattc ttgaagatgt aagaaaggca gcggatcgtc tggaggaaga gatagaggaa catgcttttg acgacaataa atcagtcaag ggggtcaatt ttgaggcagt tctgagggtg gaggaagaag aggccaattc taagcaaaat ataacaaaac gagaagtgga ggatgacttg ggtcttagca tgctgattga ctcccagaac aaccagtata ttttgaccaa gcccagagat tcaaccatcc cacgtgcaga tcaccacttt ataaaggaca ttgttaccat aggaatgctg tccttgcctt gtggctggct atgtacagcc ataggattgc ctacaatgtt tggttatatt atttgtggtg tacttctggg accttcagga ctaaatagta ttaagtctat tgtgcaagtg gagacattag gagaatttgg ggtgtttttt actctttttc ttgttggctt agaattttct ccagaaaagc taagaaaggt gtggaagatt tccttacaag ggccgtgtta catgacactg ttaatgattg catttggctt gctgtggggg catctcttgc ggatcaaacc cacgcagagc gtcttcattt ccacgtgtct gtccttgtca agcacacccc tcgtgtccag gttcctcatg ggcagtgctc ggggtgacaa agaaggcaac agaacagccc tctag. It is sometimes possible for the material contained within the vial of "TMCO3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
