Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMBIM1 cdna clone

TMBIM1 cDNA Clone

Gene Names
TMBIM1; LFG3; RECS1; MST100; PP1201; MSTP100
Synonyms
TMBIM1; TMBIM1 cDNA Clone; TMBIM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaaccccagcgccccaccaccatatgaagaccgcaaccccctgtacccaggccctccgccccctgggggctatgggcagccatctgtcctgccaggagggtatcctgcctaccctggctacccgcagcctggctacggtcaccctgctggctacccacagcccatgccccccacccacccgatgcccatgaactacggcccaggccatggctatgatggggaggagagagcggtgagtgatagcttcgggcctggagagtgggatgaccggaaagtgcgacacacttttatccgaaaggtttactccatcatctccgtgcagctgctcatcactgtggccatcattgctatcttcacctttgtggaacctgtcagcgcctttgtgaggagaaatgtggctgtctactacgtgtcctatgctgtcttcgttgtcacctacctgatccttgcctgctgccagggacccagacgccgtttcccatggaacatcattctgctgaccctttttacttttgccatgggcttcatgacgggcaccatttccagtatgtaccaaaccaaagccgtcatcattgcaatgatcatcactgcggtggtatccatttcagtcaccatcttctgctttcagaccaaggtggacttcacctcgtgcacaggcctcttctgtgtcctgggaattgtgctcctggtgactgggattgtcactagcattgtgctctacttccaatacgtttactggctccacatgctctatgctgctctgggggccatttgtttcaccctgttcctggcttacgacacacagctggtcctggggaaccggaagcacaccatcagcccggaggactacatcactggcgccctgcagatttacacagacatcatctacatcttcacctttgtgctgcagctgatgggggatcgcaattaa
Sequence Length
936
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,607 Da
NCBI Official Full Name
Homo sapiens transmembrane BAX inhibitor motif containing 1, mRNA
NCBI Official Synonym Full Names
transmembrane BAX inhibitor motif containing 1
NCBI Official Symbol
TMBIM1
NCBI Official Synonym Symbols
LFG3; RECS1; MST100; PP1201; MSTP100
NCBI Protein Information
protein lifeguard 3
UniProt Protein Name
Protein lifeguard 3
Protein Family
UniProt Gene Name
TMBIM1
UniProt Synonym Gene Names
LFG3; RECS1
UniProt Entry Name
LFG3_HUMAN

Uniprot Description

TMBIM1: Negatively regulates aortic matrix metalloproteinase-9 (MMP9) production and may play a protective role in vascular remodeling. Belongs to the BI1 family. LFG subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: endosome membrane; Golgi apparatus; lysosomal membrane

Molecular Function: death receptor binding

Biological Process: negative regulation of catalytic activity

Research Articles on TMBIM1

Similar Products

Product Notes

The TMBIM1 tmbim1 (Catalog #AAA1269261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaacc ccagcgcccc accaccatat gaagaccgca accccctgta cccaggccct ccgccccctg ggggctatgg gcagccatct gtcctgccag gagggtatcc tgcctaccct ggctacccgc agcctggcta cggtcaccct gctggctacc cacagcccat gccccccacc cacccgatgc ccatgaacta cggcccaggc catggctatg atggggagga gagagcggtg agtgatagct tcgggcctgg agagtgggat gaccggaaag tgcgacacac ttttatccga aaggtttact ccatcatctc cgtgcagctg ctcatcactg tggccatcat tgctatcttc acctttgtgg aacctgtcag cgcctttgtg aggagaaatg tggctgtcta ctacgtgtcc tatgctgtct tcgttgtcac ctacctgatc cttgcctgct gccagggacc cagacgccgt ttcccatgga acatcattct gctgaccctt tttacttttg ccatgggctt catgacgggc accatttcca gtatgtacca aaccaaagcc gtcatcattg caatgatcat cactgcggtg gtatccattt cagtcaccat cttctgcttt cagaccaagg tggacttcac ctcgtgcaca ggcctcttct gtgtcctggg aattgtgctc ctggtgactg ggattgtcac tagcattgtg ctctacttcc aatacgttta ctggctccac atgctctatg ctgctctggg ggccatttgt ttcaccctgt tcctggctta cgacacacag ctggtcctgg ggaaccggaa gcacaccatc agcccggagg actacatcac tggcgccctg cagatttaca cagacatcat ctacatcttc acctttgtgc tgcagctgat gggggatcgc aattaa. It is sometimes possible for the material contained within the vial of "TMBIM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.