TM9SF2 cdna clone

TM9SF2 cDNA Clone

Gene Names

TM9SF2; P76

Synonyms

TM9SF2; TM9SF2 cDNA Clone; TM9SF2 cdna clone

Ordering
Cat. Num. AAA1267231 For Research Use Only!

Sequence

atgagcgcgaggctgccggtgttgtctccacctcggtggccgcggctgttgctgctgtcgctgctcctgctgggggcggttcctggcccgcgccggagcggcgctttctacctgcccggcctggcgcccgtcaacttctgcgacgaagaaaaaaagagcgacgagtgcaaggccgaaatagaactatttgtgaacagacttgattcagtggaatcagttcttccttatgaatacacagcgtttgatttttgccaagcatcagaaggaaagcgcccatctgaaaatcttggtcaggtactattcggggaaagaattgaaccttcaccatataagtttacgtttaataagaaggagacctgtaagcttgtttgtacaaaaacataccatacagagaaagctgaagacaaacaaaagttagaattcttgaaaaaaagcatgttattgaattatcaacatcactggattgtggataatatgcctgtaacgtggtgttacgatgttgaagatggtcagaggttctgtaatcctggatttcctattggctgttacattacagataaaggccatgcaaaagatgcctgtgttattagttcagatttccatgaaagagatacattttacatcttcaaccatgttgacatcaaaatatactatcatgttgttgaaactgggtccatgggagcaagattagtggctgctaaacttgaaccgaaaagcttcaaacatacccatatagataaaccagactgctcagggccccccatggacataagtaacaaggcttctggggagataaaaattgcctatacttactctgttagcttcgaggaagatgataagatcagatgggcgtctagatgggactatattctggagtctatgcctcatacccacattcagtggtttagcattatgaattccctggtcattgttctcttcttatctggaatggtagctatgattatgttacggacactgcacaaagatattgctagatataatcagatggactctacggaagatgcccaggaagaatttggctggaaacttgttcatggtgatatattccgtcctccaagaaaagggatgctgctatcagtctttctaggatccgggacacagattttaattatgacctttgtgactctatttttcgcttgcctgggatttttgtcacctgccaaccgaggagcgctgatgacgtgtgctgtggtcctgtgggtgctgctgggcacccctgcaggctatgttgctgccagattctataagtcctttggaggtgagaagtggaaaacaaatgttttattaacatcatttctttgtcctgggattgtatttgctgacttctttataatgaatctgatcctctggggagaaggatcttcagcagctattccttttgggacactggttgccatattggccctttggttctgcatatctgtgcctctgacgtttattggtgcatactttggttttaagaagaatgccattgaacacccagttcgaaccaatcagattccacgtcagattcctgaacagtcgttctacacgaagcccttgcctggtattatcatgggagggattttgccctttggctgcatctttatacaacttttcttcattctgaatagtatttggtcacaccagatgtattacatgtttggcttcctatttctggtgtttatcattttggttattacctgttctgaagcaactatacttctttgctatttccacctatgtgcagaggattatcattggcaatggcgttcattccttacgagtggctttactgcagtttatttcttaatctatgcagtacactacttcttttcaaaactgcagatcacgggaacagcaagcacaattctgtactttggttataccatgataatggttttgatcttctttctttttacaggaacaattggcttctttgcatgcttttggtttgttaccaaaatatacagtgtggtgaaggttgactga

Sequence Length

1992

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

120660011

NCBI GeneID

9375

Molecular Weight

75,776 Da

NCBI Official Full Name

Homo sapiens transmembrane 9 superfamily member 2, mRNA

NCBI Official Synonym Full Names

transmembrane 9 superfamily member 2

NCBI Official Symbol

TM9SF2

NCBI Official Synonym Symbols

P76

NCBI Protein Information

transmembrane 9 superfamily member 2

UniProt Protein Name

Transmembrane 9 superfamily member 2

UniProt Gene Name

TM9SF2

UniProt Entry Name

TM9S2_HUMAN

NCBI Description

This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]

Uniprot Description

TM9SF2: In the intracellular compartments, may function as a channel or small molecule transporter. Belongs to the nonaspanin (TM9SF) family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 13q32.3

Cellular Component: endosome; integral to plasma membrane

Biological Process: transport

Research Articles on TM9SF2

1. Clinical trial of gene-disease association and gene-environment interaction. (HuGE Navigator)

Similar Products

Product Notes

The TM9SF2 tm9sf2 (Catalog #AAA1267231) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgcga ggctgccggt gttgtctcca cctcggtggc cgcggctgtt gctgctgtcg ctgctcctgc tgggggcggt tcctggcccg cgccggagcg gcgctttcta cctgcccggc ctggcgcccg tcaacttctg cgacgaagaa aaaaagagcg acgagtgcaa ggccgaaata gaactatttg tgaacagact tgattcagtg gaatcagttc ttccttatga atacacagcg tttgattttt gccaagcatc agaaggaaag cgcccatctg aaaatcttgg tcaggtacta ttcggggaaa gaattgaacc ttcaccatat aagtttacgt ttaataagaa ggagacctgt aagcttgttt gtacaaaaac ataccataca gagaaagctg aagacaaaca aaagttagaa ttcttgaaaa aaagcatgtt attgaattat caacatcact ggattgtgga taatatgcct gtaacgtggt gttacgatgt tgaagatggt cagaggttct gtaatcctgg atttcctatt ggctgttaca ttacagataa aggccatgca aaagatgcct gtgttattag ttcagatttc catgaaagag atacatttta catcttcaac catgttgaca tcaaaatata ctatcatgtt gttgaaactg ggtccatggg agcaagatta gtggctgcta aacttgaacc gaaaagcttc aaacataccc atatagataa accagactgc tcagggcccc ccatggacat aagtaacaag gcttctgggg agataaaaat tgcctatact tactctgtta gcttcgagga agatgataag atcagatggg cgtctagatg ggactatatt ctggagtcta tgcctcatac ccacattcag tggtttagca ttatgaattc cctggtcatt gttctcttct tatctggaat ggtagctatg attatgttac ggacactgca caaagatatt gctagatata atcagatgga ctctacggaa gatgcccagg aagaatttgg ctggaaactt gttcatggtg atatattccg tcctccaaga aaagggatgc tgctatcagt ctttctagga tccgggacac agattttaat tatgaccttt gtgactctat ttttcgcttg cctgggattt ttgtcacctg ccaaccgagg agcgctgatg acgtgtgctg tggtcctgtg ggtgctgctg ggcacccctg caggctatgt tgctgccaga ttctataagt cctttggagg tgagaagtgg aaaacaaatg ttttattaac atcatttctt tgtcctggga ttgtatttgc tgacttcttt ataatgaatc tgatcctctg gggagaagga tcttcagcag ctattccttt tgggacactg gttgccatat tggccctttg gttctgcata tctgtgcctc tgacgtttat tggtgcatac tttggtttta agaagaatgc cattgaacac ccagttcgaa ccaatcagat tccacgtcag attcctgaac agtcgttcta cacgaagccc ttgcctggta ttatcatggg agggattttg ccctttggct gcatctttat acaacttttc ttcattctga atagtatttg gtcacaccag atgtattaca tgtttggctt cctatttctg gtgtttatca ttttggttat tacctgttct gaagcaacta tacttctttg ctatttccac ctatgtgcag aggattatca ttggcaatgg cgttcattcc ttacgagtgg ctttactgca gtttatttct taatctatgc agtacactac ttcttttcaa aactgcagat cacgggaaca gcaagcacaa ttctgtactt tggttatacc atgataatgg ttttgatctt ctttcttttt acaggaacaa ttggcttctt tgcatgcttt tggtttgtta ccaaaatata cagtgtggtg aaggttgact ga. It is sometimes possible for the material contained within the vial of "TM9SF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

TM9SF2 cdna clone