Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TLR7 cdna clone

TLR7 cDNA Clone

Gene Names
TLR7; TLR7-like
Synonyms
TLR7; TLR7 cDNA Clone; TLR7 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgtttccaatgtggacactgaagagacaaattcttatcctttttaacataatcctaatttccaaactccttggggctagatggtttcctaaaactctgccctgtgatgtcactctggatgttccaaagaaccatgtgatcgtggactgcacagacaagcatttgacagaaattcctggaggtattcccacgaacaccacgaacctcaccctcaccattaaccacataccagacatctccccagcgtcctttcacagactggaccatctggtagagatcgatttcagatgcaactgtgtacctattccactggggtcaaaaaacaacatgtgcatcaagaggctgcagattaaacccagaagctttagtggactcacttatttaaaatccctttacctggatggaaaccagctactagagataccgcagggcctcccgcctagcttacagcttctcagccttgaggccaacaacatcttttccatcagaaaagagaatctaacagaactggccaacatagaaatactctacctgggccaaaactgttattatcgaaatccttgttatgtttcatattcaatagagaaagatgccttcctaaacttgacaaagttaaaagtgctctccctgaaagataacaatgtcacagccgtccctactgttttgccatctactttaacagaactatatctctacaacaacatgattgcaaaaatccaagaagatgattttaataacctcaaccaattacaaattcttgacctaagtggaaattgccctcgttgttataatgccccatttccttgtgcgccgtgtaaaaataattctcccctacagatccctgtaaatgcttttgatgcgctgacagaattaaaagttttacgtctacacagtaactctcttcagcatgtgcccccaagatggtttaagaacatcaacaaactccaggaactggatctgtcccaaaacttcttggccaaagaaattggggatgctaaatttctgcattttctccccagcctcatccaattggatctgtctttcaattttgaacttcaggtctatcgtgcatctatgaatctatcacaagcattttcttcactgaaaagcctgaaaattctgcggatcagaggatatgtctttaaagagttgaaaagctttaacctctcgccattacataatcttcaaaatcttgaagttcttgatcttggcactaactttataaaaattgctaacctcagcatgtttaaacaatttaaaagactgaaagtcatagatctttcagtgaataaaatatcaccttcaggagattcaagtgaagttggcttctgctcaaatgccagaacttctgtagaaagttatgaaccccaggtcctggaacaattacattatttcagatatgataagtatgcaaggagttgcagattcaaaaacaaagaggcttctttcatgtctgttaatgaaagctgctacaagtatgggcagaccttggatctaagtaaaaatagtatattttttgtcaagtcctctgattttcagcatctttctttcctcaaatgcctgaatctgtcaggaaatctcattagccaaactcttaatggcagtgaattccaacctttagcagagctgagatatttggacttctccaacaaccggcttgatttactccattcaacagcatttgaagagcttcacaaactggaagttctggatataagcagtaatagccattattttcaatcagaaggaattactcatatgctaaactttaccaagaacctaaaggttctgcagaaactgatgatgaacgacaatgacatctcttcctccaccagcaggaccatggagagtgagtctcttagaactctggaattcagaggaaatcacttagatgttttatggagagaaggtgataacagatacttacaattattcaagaatctgctaaaattagaggaattagacatctctaaaaattccctaagtttcttgccttctggagtttttgatggtatgcctccaaatctaaagaatctctctttggccaaaaatgggctcaaatctttcagttggaagaaactccagtgtctaaagaacctggaaactttggacctcagccacaaccaactgaccactgtccctgagagattatccaactgttccagaagcctcaagaatctgattcttaagaataatcaaatcaggagtctgacgaagtattttctacaagatgccttccagttgcgatatctggatctcagctcaaataaaatccagatgatccaaaagaccagcttcccagaaaatgtcctcaacaatctgaagatgttgcttttgcatcataatcggtttctgtgcacctgtgatgctgtgtggtttgtctggtgggttaaccatacagaggtgactattccttacctggccacagatgtgacttgtgtggggccaggagcacacaagggccaaagtgtgatctccctggatctgtacacctgtgagttagatctgactaacctgattctgttctcactttccatatctgtatctctctttctcatggtgatgatgacagcaagtcacctctatttctgggatgtgtggtatatttaccatttctgtaaggccaagataaaggggtatcagcgtctaatatcaccagactgttgctatgatgcttttattgtgtatgacactaaagacccagctgtgaccgagtgggttttggctgagctggtggccaaactggaagacccaagagagaaacattttaatttatgtctcgaggaaagggactggttaccagggcagccagttctggaaaacctttcccagagcatacagcttagcaaaaagacagtgtttgtgatgacagacaagtatgcaaagactgaaaattttaagatagcattttacttgtcccatcagaggctcatggatgaaaaagttgatgtgattatcttgatatttcttgagaagccctttcagaagtccaagttcctccagctccggaaaaggctctgtgggagttctgtccttgagtggccaacaaacccgcaagctcacccatacttctggcagtgtctaaagaacgccctggccacagacaatcatgtggcctatagtcaggtgttcaaggaaacggtctag
Sequence Length
3150
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
120,922 Da
NCBI Official Full Name
Homo sapiens toll-like receptor 7, mRNA
NCBI Official Synonym Full Names
toll like receptor 7
NCBI Official Symbol
TLR7
NCBI Official Synonym Symbols
TLR7-like
NCBI Protein Information
toll-like receptor 7
UniProt Protein Name
Toll-like receptor 7
Protein Family
UniProt Gene Name
TLR7
UniProt Entry Name
TLR7_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008]

Uniprot Description

TLR7: Key component of innate and adaptive immunity. TLRs (Toll-like receptors) control host immune response against pathogens through recognition of molecular patterns specific to microorganisms. TLR7 is a nucleotide-sensing TLR which is activated by single-stranded RNA. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Interacts with MYD88 via their respective TIR domains. Interacts with UNC93B1. Detected in brain, placenta, spleen, stomach, small intestine, lung and in plasmacytoid pre-dendritic cells. Belongs to the Toll-like receptor family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: Xp22.3

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; endosome; endosome membrane; Golgi membrane; integral to plasma membrane; lysosome; plasma membrane; receptor complex

Molecular Function: double-stranded RNA binding; receptor activity; single-stranded RNA binding; siRNA binding

Biological Process: defense response to virus; I-kappaB phosphorylation; inflammatory response; positive regulation of chemokine production; positive regulation of inflammatory response; positive regulation of interferon-alpha biosynthetic process; positive regulation of interferon-beta biosynthetic process; positive regulation of interferon-gamma biosynthetic process; positive regulation of interleukin-8 biosynthetic process; positive regulation of interleukin-8 production; positive regulation of NF-kappaB import into nucleus; toll-like receptor 7 signaling pathway; toll-like receptor 9 signaling pathway; toll-like receptor signaling pathway

Research Articles on TLR7

Similar Products

Product Notes

The TLR7 tlr7 (Catalog #AAA1270492) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtttc caatgtggac actgaagaga caaattctta tcctttttaa cataatccta atttccaaac tccttggggc tagatggttt cctaaaactc tgccctgtga tgtcactctg gatgttccaa agaaccatgt gatcgtggac tgcacagaca agcatttgac agaaattcct ggaggtattc ccacgaacac cacgaacctc accctcacca ttaaccacat accagacatc tccccagcgt cctttcacag actggaccat ctggtagaga tcgatttcag atgcaactgt gtacctattc cactggggtc aaaaaacaac atgtgcatca agaggctgca gattaaaccc agaagcttta gtggactcac ttatttaaaa tccctttacc tggatggaaa ccagctacta gagataccgc agggcctccc gcctagctta cagcttctca gccttgaggc caacaacatc ttttccatca gaaaagagaa tctaacagaa ctggccaaca tagaaatact ctacctgggc caaaactgtt attatcgaaa tccttgttat gtttcatatt caatagagaa agatgccttc ctaaacttga caaagttaaa agtgctctcc ctgaaagata acaatgtcac agccgtccct actgttttgc catctacttt aacagaacta tatctctaca acaacatgat tgcaaaaatc caagaagatg attttaataa cctcaaccaa ttacaaattc ttgacctaag tggaaattgc cctcgttgtt ataatgcccc atttccttgt gcgccgtgta aaaataattc tcccctacag atccctgtaa atgcttttga tgcgctgaca gaattaaaag ttttacgtct acacagtaac tctcttcagc atgtgccccc aagatggttt aagaacatca acaaactcca ggaactggat ctgtcccaaa acttcttggc caaagaaatt ggggatgcta aatttctgca ttttctcccc agcctcatcc aattggatct gtctttcaat tttgaacttc aggtctatcg tgcatctatg aatctatcac aagcattttc ttcactgaaa agcctgaaaa ttctgcggat cagaggatat gtctttaaag agttgaaaag ctttaacctc tcgccattac ataatcttca aaatcttgaa gttcttgatc ttggcactaa ctttataaaa attgctaacc tcagcatgtt taaacaattt aaaagactga aagtcataga tctttcagtg aataaaatat caccttcagg agattcaagt gaagttggct tctgctcaaa tgccagaact tctgtagaaa gttatgaacc ccaggtcctg gaacaattac attatttcag atatgataag tatgcaagga gttgcagatt caaaaacaaa gaggcttctt tcatgtctgt taatgaaagc tgctacaagt atgggcagac cttggatcta agtaaaaata gtatattttt tgtcaagtcc tctgattttc agcatctttc tttcctcaaa tgcctgaatc tgtcaggaaa tctcattagc caaactctta atggcagtga attccaacct ttagcagagc tgagatattt ggacttctcc aacaaccggc ttgatttact ccattcaaca gcatttgaag agcttcacaa actggaagtt ctggatataa gcagtaatag ccattatttt caatcagaag gaattactca tatgctaaac tttaccaaga acctaaaggt tctgcagaaa ctgatgatga acgacaatga catctcttcc tccaccagca ggaccatgga gagtgagtct cttagaactc tggaattcag aggaaatcac ttagatgttt tatggagaga aggtgataac agatacttac aattattcaa gaatctgcta aaattagagg aattagacat ctctaaaaat tccctaagtt tcttgccttc tggagttttt gatggtatgc ctccaaatct aaagaatctc tctttggcca aaaatgggct caaatctttc agttggaaga aactccagtg tctaaagaac ctggaaactt tggacctcag ccacaaccaa ctgaccactg tccctgagag attatccaac tgttccagaa gcctcaagaa tctgattctt aagaataatc aaatcaggag tctgacgaag tattttctac aagatgcctt ccagttgcga tatctggatc tcagctcaaa taaaatccag atgatccaaa agaccagctt cccagaaaat gtcctcaaca atctgaagat gttgcttttg catcataatc ggtttctgtg cacctgtgat gctgtgtggt ttgtctggtg ggttaaccat acagaggtga ctattcctta cctggccaca gatgtgactt gtgtggggcc aggagcacac aagggccaaa gtgtgatctc cctggatctg tacacctgtg agttagatct gactaacctg attctgttct cactttccat atctgtatct ctctttctca tggtgatgat gacagcaagt cacctctatt tctgggatgt gtggtatatt taccatttct gtaaggccaa gataaagggg tatcagcgtc taatatcacc agactgttgc tatgatgctt ttattgtgta tgacactaaa gacccagctg tgaccgagtg ggttttggct gagctggtgg ccaaactgga agacccaaga gagaaacatt ttaatttatg tctcgaggaa agggactggt taccagggca gccagttctg gaaaaccttt cccagagcat acagcttagc aaaaagacag tgtttgtgat gacagacaag tatgcaaaga ctgaaaattt taagatagca ttttacttgt cccatcagag gctcatggat gaaaaagttg atgtgattat cttgatattt cttgagaagc cctttcagaa gtccaagttc ctccagctcc ggaaaaggct ctgtgggagt tctgtccttg agtggccaac aaacccgcaa gctcacccat acttctggca gtgtctaaag aacgccctgg ccacagacaa tcatgtggcc tatagtcagg tgttcaagga aacggtctag. It is sometimes possible for the material contained within the vial of "TLR7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.