TLE3 cdna clone
TLE3 cDNA Clone
Gene Names
TLE3; ESG; ESG3; GRG3; HsT18976
Synonyms
TLE3; TLE3 cDNA Clone; TLE3 cdna clone
Sequence
atgcccccgccccctcccctgtcttgtcttcgcgggctccaggctccccatcaacccgggcagccgggatttaaattcacggtggctgagtcttgtgacaggatcaaagacgaattccagttcctgcaagctcagtatcacagcctcaaagtggagtacgacaagctggcaaacgagaagacggagatgcagcgccattatgtgatgtactatgagatgtcctatggcttgaacattgaaatgcacaagcagacagagattgcgaagagactgaacacaattttagcacagatcatgcctttcctgtcacaagagcaccagcagcaggtggcgcaggcagtggagcgcgccaagcaggtcaccatgacggagctgaacgccatcatcgggcagcagctccaggcgcagcacctctcccatgccacacacggccccccggtccagttgccaccccacccgtcaggtctccagcctccaggaatccccccagtgacagggagcagctccgggctgctggcactgggcgccctgggcagccaggcccatctgacggtgaaggatgagaagaaccaccatgaactcgatcacagagagagagaatccagtgcgaataactctgtgtcaccctcggaaagcctccgggccagtgagaagcaccggggctctgcggactacagcatggaagccaagaagcggaaggcggaagagaaggacagcttgagccgatacgacagtgatggggacaagagtgatgatctggtggtggatgtttccaatgaggaccccgcaacgccccgggtcagcccggcacactcccctcctgaaaatgggctggacaaggcccgtagcctgaaaaaagatgcccccaccagccctgcctcggtggcctcttccagtagcacaccttcctccaagaccaaagaccttggtcataacgacaaatcctccacccctgggctcaagtccaacacaccaaccccaaggaacgacgccccaactccaggcaccagcacgaccccagggctcaggtcgatgccgggtaaacctccgggcatggacccgataggtataatggcctcggctctgcgcacgcccatctccatcaccagctcctatgcggcgcccttcgccatgatgagccaccatgagatgaacggctccctcaccagtcctggcgcctacgccggcctccacaacatcccaccccagatgagcgccgccgccgctgctgcagccgctacctatggccgatcgccaatggttggttttgaccctcaccccccgatgcgggccacaggcctcccctcaagcctggcctccattcctggaggaaaaccagcgtactcattccatgtgagtgctgatgggcagatgcagcccgtgcccttcccccacgacgccctggcaggccccggcatcccgaggcacgcccggcagatcaacacactcagccacggggaggtggtgtgtgccgtgaccatcagcaaccccacgaggcacgtctacacaggtggcaagggctgcgtgaagatctgggacatcagccagccaggcagcaagagccccatctcccagctggactgcctgaacagggacaattacatccgctcctgcaagctgctccctgatgggcgcacgctcatcgtgggcggcgaggccagcacgctcaccatctgggacctggcctcacccacgccccgcatcaaggccgagctgacgtcctcggctcccgcctgttatgccctggccattagccctgacgccaaagtctgcttctcctgctgcagcgatgggaacattgctgtctgggacctgcacaaccagaccctggtcaggcagttccagggccacacagatggggccagctgcatagacatctcccatgatggcaccaaactgtggacagggggcctggacaacacagtgcgctcctgggacctgcgggagggccgacagctacagcagcatgacttcacttcccagatcttctcgctgggctactgccccactggggagtggctggctgtgggcatggagagcagcaacgtggaggtgctgcaccacaccaagcctgacaagtaccagctgcacctgcacgagagctgcgtgctctccctcaagttcgcctactgcggcaagtggttcgtgagcactgggaaagataaccttctcaacgcctggaggacgccttatggagccagcatattccagtctaaagaatcctcgtctgtcttgagttgtgacatttcagcggatgacaaatacattgtaacaggctctggtgacaagaaggccacagtttatgaggtcatctactaa
Sequence Length
2319
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,279 Da
NCBI Official Full Name
Homo sapiens transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila), mRNA
NCBI Official Synonym Full Names
transducin like enhancer of split 3
NCBI Official Symbol
TLE3
NCBI Official Synonym Symbols
ESG; ESG3; GRG3; HsT18976
NCBI Protein Information
transducin-like enhancer protein 3
UniProt Protein Name
Transducin-like enhancer protein 3
Protein Family
UniProt Gene Name
TLE3
UniProt Synonym Gene Names
KIAA1547; ESG3
UniProt Entry Name
TLE3_HUMAN
NCBI Description
This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Uniprot Description
Transcriptional corepressor that binds to a number of transcription factors. Inhibits the transcriptional activation mediated by CTNNB1 and TCF family members in Wnt signaling. The effects of full-length TLE family members may be modulated by association with dominant-negative AES ().
Research Articles on TLE3
Similar Products
Product Notes
The TLE3 tle3 (Catalog #AAA1272717) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccccgc cccctcccct gtcttgtctt cgcgggctcc aggctcccca tcaacccggg cagccgggat ttaaattcac ggtggctgag tcttgtgaca ggatcaaaga cgaattccag ttcctgcaag ctcagtatca cagcctcaaa gtggagtacg acaagctggc aaacgagaag acggagatgc agcgccatta tgtgatgtac tatgagatgt cctatggctt gaacattgaa atgcacaagc agacagagat tgcgaagaga ctgaacacaa ttttagcaca gatcatgcct ttcctgtcac aagagcacca gcagcaggtg gcgcaggcag tggagcgcgc caagcaggtc accatgacgg agctgaacgc catcatcggg cagcagctcc aggcgcagca cctctcccat gccacacacg gccccccggt ccagttgcca ccccacccgt caggtctcca gcctccagga atccccccag tgacagggag cagctccggg ctgctggcac tgggcgccct gggcagccag gcccatctga cggtgaagga tgagaagaac caccatgaac tcgatcacag agagagagaa tccagtgcga ataactctgt gtcaccctcg gaaagcctcc gggccagtga gaagcaccgg ggctctgcgg actacagcat ggaagccaag aagcggaagg cggaagagaa ggacagcttg agccgatacg acagtgatgg ggacaagagt gatgatctgg tggtggatgt ttccaatgag gaccccgcaa cgccccgggt cagcccggca cactcccctc ctgaaaatgg gctggacaag gcccgtagcc tgaaaaaaga tgcccccacc agccctgcct cggtggcctc ttccagtagc acaccttcct ccaagaccaa agaccttggt cataacgaca aatcctccac ccctgggctc aagtccaaca caccaacccc aaggaacgac gccccaactc caggcaccag cacgacccca gggctcaggt cgatgccggg taaacctccg ggcatggacc cgataggtat aatggcctcg gctctgcgca cgcccatctc catcaccagc tcctatgcgg cgcccttcgc catgatgagc caccatgaga tgaacggctc cctcaccagt cctggcgcct acgccggcct ccacaacatc ccaccccaga tgagcgccgc cgccgctgct gcagccgcta cctatggccg atcgccaatg gttggttttg accctcaccc cccgatgcgg gccacaggcc tcccctcaag cctggcctcc attcctggag gaaaaccagc gtactcattc catgtgagtg ctgatgggca gatgcagccc gtgcccttcc cccacgacgc cctggcaggc cccggcatcc cgaggcacgc ccggcagatc aacacactca gccacgggga ggtggtgtgt gccgtgacca tcagcaaccc cacgaggcac gtctacacag gtggcaaggg ctgcgtgaag atctgggaca tcagccagcc aggcagcaag agccccatct cccagctgga ctgcctgaac agggacaatt acatccgctc ctgcaagctg ctccctgatg ggcgcacgct catcgtgggc ggcgaggcca gcacgctcac catctgggac ctggcctcac ccacgccccg catcaaggcc gagctgacgt cctcggctcc cgcctgttat gccctggcca ttagccctga cgccaaagtc tgcttctcct gctgcagcga tgggaacatt gctgtctggg acctgcacaa ccagaccctg gtcaggcagt tccagggcca cacagatggg gccagctgca tagacatctc ccatgatggc accaaactgt ggacaggggg cctggacaac acagtgcgct cctgggacct gcgggagggc cgacagctac agcagcatga cttcacttcc cagatcttct cgctgggcta ctgccccact ggggagtggc tggctgtggg catggagagc agcaacgtgg aggtgctgca ccacaccaag cctgacaagt accagctgca cctgcacgag agctgcgtgc tctccctcaa gttcgcctac tgcggcaagt ggttcgtgag cactgggaaa gataaccttc tcaacgcctg gaggacgcct tatggagcca gcatattcca gtctaaagaa tcctcgtctg tcttgagttg tgacatttca gcggatgaca aatacattgt aacaggctct ggtgacaaga aggccacagt ttatgaggtc atctactaa. It is sometimes possible for the material contained within the vial of "TLE3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
