Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TIRAP cdna clone

TIRAP cDNA Clone

Gene Names
TIRAP; Mal; wyatt; BACTS1; MyD88-2
Synonyms
TIRAP; TIRAP cDNA Clone; TIRAP cdna clone
Ordering
For Research Use Only!
Sequence
atggcatcatcgacctccctcccagctcctggctctcggcctaagaagcctctaggcaagatggctgactggttcaggcagaccctgctgaagaagcccaagaagaggcccaactccccagaaagcacctccagcgatgcttcacagcctacctcacaggacagcccactacccccaagcctcagctcagtcacgtctcccagcctgccacccacacatgcgagtgacagtggcagtagtcgctggagcaaagactatgacgtctgcgtgtgccacagtgaggaagacctggtggccgcccaggacctggtctcctacttggaaggcagcactgccagcctgcgctgcttcctgcaactccgggatgcaaccccaggcggcgctatagtgtccgagctgtgccaggcactgagcagtagtcactgccgggtgctgctcatcacgccgggcttccttcaggacccctggtgcaagtaccagatgctgcaggccctgaccgaggctccaggggccgagggctgcaccatccccctgctgtcgggcctcagcagagctgcctacccacctgagctccgattcatgtactacgtcgatggcaggggccctgatggtggctttcgtcaagtcaaagaagctgtcatgcgttatctgcagacactcagttggcacttgttatatcatgggaccccggaaattggagtgaagctagaaacagaaaacccatgcagggcctcggattcccacaaatgtgacaagaggtatagggagtga
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,948 Da
NCBI Official Full Name
Homo sapiens toll-interleukin 1 receptor (TIR) domain containing adaptor protein, mRNA
NCBI Official Synonym Full Names
TIR domain containing adaptor protein
NCBI Official Symbol
TIRAP
NCBI Official Synonym Symbols
Mal; wyatt; BACTS1; MyD88-2
NCBI Protein Information
toll/interleukin-1 receptor domain-containing adapter protein
UniProt Protein Name
Toll/interleukin-1 receptor domain-containing adapter protein
UniProt Gene Name
TIRAP
UniProt Synonym Gene Names
MAL; TIR domain-containing adapter protein; MyD88-2
UniProt Entry Name
TIRAP_HUMAN

NCBI Description

The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]

Uniprot Description

TIRAP: an adapter protein involved in the TLR4 signaling pathway in the innate immune response. Acts via IRAK2 and TRAF-6, leading to the activation of NF-kappa-B, ERK1, ERK2 and JNK, resulting in cytokine secretion and the inflammatory response. Homodimerizes. Also forms heterodimers with MyD88. Binds to TLR4 and IRAK2 via their respective TIR domains. Binds to PKR and TBK1. Does not interact with IRAK1, nor TLR9. Genetic variations in TIRAP can influence susceptibility or resistance to infectious diseases, including invasive pneumococcal disease, malaria and tuberculosis. Three isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: cytoplasm; cytosol; endocytic vesicle; intercellular bridge; nucleoplasm; plasma membrane

Molecular Function: phosphatidylinositol-4,5-bisphosphate binding; protein binding; protein heterodimerization activity; protein homodimerization activity; protein kinase C binding

Biological Process: activation of NF-kappaB transcription factor; activation of NF-kappaB-inducing kinase; cell surface receptor linked signal transduction; defense response to Gram-positive bacterium; MyD88-dependent toll-like receptor signaling pathway; myeloid cell differentiation; positive regulation of B cell proliferation; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-12 production; positive regulation of interleukin-15 production; positive regulation of interleukin-6 biosynthetic process; positive regulation of interleukin-8 production; positive regulation of JNK cascade; positive regulation of toll-like receptor 2 signaling pathway; positive regulation of toll-like receptor 3 signaling pathway; positive regulation of toll-like receptor 4 signaling pathway; positive regulation of tumor necrosis factor production; regulation of innate immune response; regulation of interferon-beta production; response to lipopolysaccharide; toll-like receptor 4 signaling pathway

Disease: Bacteremia, Susceptibility To, 1; Invasive Pneumococcal Disease, Recurrent Isolated, 1; Malaria, Susceptibility To; Mycobacterium Tuberculosis, Susceptibility To

Research Articles on TIRAP

Similar Products

Product Notes

The TIRAP tirap (Catalog #AAA1273403) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcat cgacctccct cccagctcct ggctctcggc ctaagaagcc tctaggcaag atggctgact ggttcaggca gaccctgctg aagaagccca agaagaggcc caactcccca gaaagcacct ccagcgatgc ttcacagcct acctcacagg acagcccact acccccaagc ctcagctcag tcacgtctcc cagcctgcca cccacacatg cgagtgacag tggcagtagt cgctggagca aagactatga cgtctgcgtg tgccacagtg aggaagacct ggtggccgcc caggacctgg tctcctactt ggaaggcagc actgccagcc tgcgctgctt cctgcaactc cgggatgcaa ccccaggcgg cgctatagtg tccgagctgt gccaggcact gagcagtagt cactgccggg tgctgctcat cacgccgggc ttccttcagg acccctggtg caagtaccag atgctgcagg ccctgaccga ggctccaggg gccgagggct gcaccatccc cctgctgtcg ggcctcagca gagctgccta cccacctgag ctccgattca tgtactacgt cgatggcagg ggccctgatg gtggctttcg tcaagtcaaa gaagctgtca tgcgttatct gcagacactc agttggcact tgttatatca tgggaccccg gaaattggag tgaagctaga aacagaaaac ccatgcaggg cctcggattc ccacaaatgt gacaagaggt atagggagtg a. It is sometimes possible for the material contained within the vial of "TIRAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.