Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TFPI cdna clone

TFPI cDNA Clone

Gene Names
TFPI; EPI; TFI; LACI; TFPI1
Synonyms
TFPI; TFPI cDNA Clone; TFPI cdna clone
Ordering
For Research Use Only!
Sequence
atgatttacacaatgaagaaagtacatgcactttgggcttctgtatgcctgctgcttaatcttgcccctgcccctcttaatgctgattctgaggaagatgaagaacacacaattatcacagatacggagttgccaccactgaaacttatgcattcattttgtgcattcaaggcggatgatggcccatgtaaagcaatcatgaaaagatttttcttcaatattttcactcgacagtgcgaagaatttatatatgggggatgtgaaggaaatcagaatcgatttgaaagtctggaagagtgcaaaaaaatgtgtacaagagataatgcaaacaggattataaagacaacattgcaacaagaaaagccagatttctgctttttggaagaagatcctggaatatgtcgaggttatattaccaggtatttttataacaatcagacaaaacagtgtgaacgtttcaagtatggtggatgcctgggcaatatgaacaattttgagacactggaagaatgcaagaacatttgtgaagatggtccgaatggtttccaggtggataattatggaacccagctcaatgctgtgaataactccctgactccgcaatcaaccaaggttcccagcctttttgttacaaaagaaggaacaaatgatggttggaagaatgcggctcatatttaccaagtctttctgaacgccttctgcattcatgcatccatgttctttctaggattggatagcatttcatgcctatgttaa
Sequence Length
756
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,653 Da
NCBI Official Full Name
Homo sapiens tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor), mRNA
NCBI Official Synonym Full Names
tissue factor pathway inhibitor
NCBI Official Symbol
TFPI
NCBI Official Synonym Symbols
EPI; TFI; LACI; TFPI1
NCBI Protein Information
tissue factor pathway inhibitor
UniProt Protein Name
Tissue factor pathway inhibitor
UniProt Gene Name
TFPI
UniProt Synonym Gene Names
LACI; TFPI1; TFPI; EPI; LACI
UniProt Entry Name
TFPI1_HUMAN

NCBI Description

This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]

Uniprot Description

TFPI: Inhibits factor X (X(a)) directly and, in a Xa-dependent way, inhibits VIIa/tissue factor activity, presumably by forming a quaternary Xa/LACI/VIIa/TF complex. It possesses an antithrombotic action and also the ability to associate with lipoproteins in plasma. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Membrane protein, GPI anchor; Inhibitor; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 2q32

Cellular Component: cell surface; extracellular region; extracellular space; plasma membrane

Molecular Function: endopeptidase inhibitor activity

Biological Process: blood coagulation; blood coagulation, extrinsic pathway

Research Articles on TFPI

Similar Products

Product Notes

The TFPI tfpi (Catalog #AAA1268003) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatttaca caatgaagaa agtacatgca ctttgggctt ctgtatgcct gctgcttaat cttgcccctg cccctcttaa tgctgattct gaggaagatg aagaacacac aattatcaca gatacggagt tgccaccact gaaacttatg cattcatttt gtgcattcaa ggcggatgat ggcccatgta aagcaatcat gaaaagattt ttcttcaata ttttcactcg acagtgcgaa gaatttatat atgggggatg tgaaggaaat cagaatcgat ttgaaagtct ggaagagtgc aaaaaaatgt gtacaagaga taatgcaaac aggattataa agacaacatt gcaacaagaa aagccagatt tctgcttttt ggaagaagat cctggaatat gtcgaggtta tattaccagg tatttttata acaatcagac aaaacagtgt gaacgtttca agtatggtgg atgcctgggc aatatgaaca attttgagac actggaagaa tgcaagaaca tttgtgaaga tggtccgaat ggtttccagg tggataatta tggaacccag ctcaatgctg tgaataactc cctgactccg caatcaacca aggttcccag cctttttgtt acaaaagaag gaacaaatga tggttggaag aatgcggctc atatttacca agtctttctg aacgccttct gcattcatgc atccatgttc tttctaggat tggatagcat ttcatgccta tgttaa. It is sometimes possible for the material contained within the vial of "TFPI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.