Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TFAP2A cdna clone

TFAP2A cDNA Clone

Gene Names
TFAP2A; AP-2; BOFS; AP2TF; TFAP2; AP-2alpha
Synonyms
TFAP2A; TFAP2A cDNA Clone; TFAP2A cdna clone
Ordering
For Research Use Only!
Sequence
atgttagttcacagtttttcagccatggaccgtcacgacggcaccagcaacgggacggcacggttgccccagctgggcactgtaggtcaatctccctacacgagcgccccgccgctgtcccacacccccaatgccgacttccagcccccatacttccccccaccctaccagcctatctacccccagtcgcaagatccttactcccacgtcaacgacccctacagcctgaaccccctgcacgcccagccgcagccgcagcacccaggctggcccggccagaggcagagccaggagtctgggctcctgcacacgcaccgggggctgcctcaccagctgtcgggcctggatcctcgcagggactacaggcggcacgaggacctcctgcacggcccacacgcgctcagctcaggactcggagacctctcgatccactccttacctcacgccatcgaggaggtcccgcatgtagaagacccgggtattaacatcccagatcaaactgtaattaagaaaggccccgtgtccctgtccaagtccaacagcaatgccgtctccgccatccctattaacaaggacaacctcttcggcggcgtggtgaaccccaacgaagtcttctgttcagttccgggtcgcctctcgctcctcagctccacctcgaagtacaaggtcacggtggcggaagtgcagcggcggctctcaccacccgagtgtctcaacgcgtcgctgctgggcggagtgctccggagggcgaagtctaaaaatggaggaagatctttaagagaaaaactggacaaaataggattaaatctgcctgcagggagacgtaaagctgccaacgttaccctgctcacatcactagtagagggagaagctgtccacctagccagggactttgggtacgtgtgcgaaaccgaatttcctgccaaagcagtagctgaatttctcaaccgacaacattccgatcccaatgagcaagtgacaagaaaaaacatgctcctggctacaaaacagatatgcaaagagttcaccgacctgctggctcaggaccgatctcccctggggaactcacggcccaaccccatcctggagcccggcatccagagctgcttgacccacttcaacctcatctcccacggcttcggcagccccgcggtgtgtgccgcggtcacggccctgcagaactatctcaccgaggccctcaaggccatggacaaaatgtacctcagcaacaaccccaatagccacacggacaacaacgccaaaagcagtgacaaagaggagaagcacagaaagtga
Sequence Length
1296
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,440 Da
NCBI Official Full Name
Homo sapiens transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha), mRNA
NCBI Official Synonym Full Names
transcription factor AP-2 alpha
NCBI Official Symbol
TFAP2A
NCBI Official Synonym Symbols
AP-2; BOFS; AP2TF; TFAP2; AP-2alpha
NCBI Protein Information
transcription factor AP-2-alpha
UniProt Protein Name
Transcription factor AP-2-alpha
Protein Family
UniProt Gene Name
TFAP2A
UniProt Synonym Gene Names
AP2TF; TFAP2; AP2-alpha; AP-2
UniProt Entry Name
AP2A_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor that binds the consensus sequence 5'-GCCNNNGGC-3'. The encoded protein functions as either a homodimer or as a heterodimer with similar family members. This protein activates the transcription of some genes while inhibiting the transcription of others. Defects in this gene are a cause of branchiooculofacial syndrome (BOFS). Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]

Uniprot Description

AP-2 alpha: Sequence-specific DNA-binding protein that interacts with inducible viral and cellular enhancer elements to regulate transcription of selected genes. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. AP-2-alpha is the only AP-2 protein required for early morphogenesis of the lens vesicle. Together with the CITED2 coactivator, stimulates the PITX2 P1 promoter transcription activation. Associates with chromatin to the PITX2 P1 promoter region. Binds DNA as a dimer. Can form homodimers or heterodimers with other AP-2 family members. Interacts with WWOX. Interacts with CITED4. Interacts with UBE2I. Interacts with RALBP1 in a complex also containing EPN1 and NUMB during interphase and mitosis. Interacts with KCTD1; this interaction represses transcription activation. Interacts (via C-terminus) with CITED2 (via C-terminus); the interaction stimulates TFAP2A- transcriptional activation. Interacts (via N-terminus) with EP300 (via N-terminus); the interaction requires CITED2. Belongs to the AP-2 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 6p24

Cellular Component: centrosome; cytoplasm; Golgi apparatus; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: chromatin binding; protein binding; protein dimerization activity; protein homodimerization activity; sequence-specific DNA binding; transcription coactivator activity

Biological Process: embryonic cranial skeleton morphogenesis; embryonic forelimb morphogenesis; inner ear morphogenesis; kidney development; negative regulation of apoptosis; negative regulation of cell proliferation; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; oculomotor nerve formation; palate development; positive regulation of bone mineralization; positive regulation of neuron apoptosis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of cell differentiation; sensory perception of sound; trigeminal nerve development

Disease: Branchiooculofacial Syndrome

Research Articles on TFAP2A

Similar Products

Product Notes

The TFAP2A tfap2a (Catalog #AAA1277024) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttagttc acagtttttc agccatggac cgtcacgacg gcaccagcaa cgggacggca cggttgcccc agctgggcac tgtaggtcaa tctccctaca cgagcgcccc gccgctgtcc cacaccccca atgccgactt ccagccccca tacttccccc caccctacca gcctatctac ccccagtcgc aagatcctta ctcccacgtc aacgacccct acagcctgaa ccccctgcac gcccagccgc agccgcagca cccaggctgg cccggccaga ggcagagcca ggagtctggg ctcctgcaca cgcaccgggg gctgcctcac cagctgtcgg gcctggatcc tcgcagggac tacaggcggc acgaggacct cctgcacggc ccacacgcgc tcagctcagg actcggagac ctctcgatcc actccttacc tcacgccatc gaggaggtcc cgcatgtaga agacccgggt attaacatcc cagatcaaac tgtaattaag aaaggccccg tgtccctgtc caagtccaac agcaatgccg tctccgccat ccctattaac aaggacaacc tcttcggcgg cgtggtgaac cccaacgaag tcttctgttc agttccgggt cgcctctcgc tcctcagctc cacctcgaag tacaaggtca cggtggcgga agtgcagcgg cggctctcac cacccgagtg tctcaacgcg tcgctgctgg gcggagtgct ccggagggcg aagtctaaaa atggaggaag atctttaaga gaaaaactgg acaaaatagg attaaatctg cctgcaggga gacgtaaagc tgccaacgtt accctgctca catcactagt agagggagaa gctgtccacc tagccaggga ctttgggtac gtgtgcgaaa ccgaatttcc tgccaaagca gtagctgaat ttctcaaccg acaacattcc gatcccaatg agcaagtgac aagaaaaaac atgctcctgg ctacaaaaca gatatgcaaa gagttcaccg acctgctggc tcaggaccga tctcccctgg ggaactcacg gcccaacccc atcctggagc ccggcatcca gagctgcttg acccacttca acctcatctc ccacggcttc ggcagccccg cggtgtgtgc cgcggtcacg gccctgcaga actatctcac cgaggccctc aaggccatgg acaaaatgta cctcagcaac aaccccaata gccacacgga caacaacgcc aaaagcagtg acaaagagga gaagcacaga aagtga. It is sometimes possible for the material contained within the vial of "TFAP2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.