Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TEAD4 cdna clone

TEAD4 cDNA Clone

Gene Names
TEAD4; TEF3; RTEF1; TEF-3; EFTR-2; TEFR-1; TCF13L1; hRTEF-1B
Synonyms
TEAD4; TEAD4 cDNA Clone; TEAD4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatggtcggaacgagctgattgcccgctacatcaagctccggacagggaagacccgcaccaggaagcaggtctccagccacatccaggtgctggctcgtcgcaaagctcgcgagatccaggccaagctaaaggaccaggcagctaaggacaaggccctgcagagcatggctgccatgtcgtctgcacagatcatctccgccacggccttccacagtagcatggccctcgcccggggccccggccgcccagcagtctcagggttttggcaaggagctttgccaggccaagccggaacgtcccatgatgtgaagcctttctctcagcaaacctatgctgtccagcctccgctgcctctgccagggtttgagtctcctgcagggcccgccccatcgccctctgcgcccccggcacccccatggcagggccgcagcgtggccagctccaagctctggatgttggagttctctgccttcctggagcagcagcaggacccggacacgtacaacaagcacctgttcgtgcacattggccagtccagcccaagctacagcgacccctacctcgaagccgtggacatccgccaaatctatgacaaattcccggagaaaaagggtggactcaaggatctcttcgaacggggaccctccaatgccttttttcttgtgaagttctgggcagacctcaacaccaacatcgaggatgaaggcagctccttctatggggtctccagccagtatgagagccccgagaacatgatcatcacctgctccacgaaggtctgctctttcggcaagcaggtggtggagaaagttgagacagagtatgctcgctatgagaatggacactactcttaccgcatccaccggtccccgctctgtgagtacatgatcaacttcatccacaagctcaagcacctccctgagaagtacatgatgaacagcgtgctggagaacttcaccatcctgcaggtggtcaccaacagagacacacaggagaccttgctgtgcattgcctatgtctttgaggtgtcagccagtgagcacggggctcagcaccacatctacaggctggtgaaagaatga
Sequence Length
1086
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,058 Da
NCBI Official Full Name
Homo sapiens TEA domain family member 4, mRNA
NCBI Official Synonym Full Names
TEA domain transcription factor 4
NCBI Official Symbol
TEAD4
NCBI Official Synonym Symbols
TEF3; RTEF1; TEF-3; EFTR-2; TEFR-1; TCF13L1; hRTEF-1B
NCBI Protein Information
transcriptional enhancer factor TEF-3
UniProt Protein Name
Transcriptional enhancer factor TEF-3
UniProt Gene Name
TEAD4
UniProt Synonym Gene Names
RTEF1; TCF13L1; TEF3; TEAD-4
UniProt Entry Name
TEAD4_HUMAN

NCBI Description

This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

TEAD4: Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds specifically and non-cooperatively to the Sph and GT-IIC 'enhansons' (5'-GTGGAATGT-3') and activates transcription. Binds to the M-CAT motif. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 12p13.3-p13.2

Cellular Component: nucleoplasm

Molecular Function: protein binding; transcription factor activity

Biological Process: muscle development; positive regulation of defense response to virus by host; regulation of transcription from RNA polymerase II promoter; skeletal development; transcription initiation from RNA polymerase II promoter

Research Articles on TEAD4

Similar Products

Product Notes

The TEAD4 tead4 (Catalog #AAA1267011) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatggtc ggaacgagct gattgcccgc tacatcaagc tccggacagg gaagacccgc accaggaagc aggtctccag ccacatccag gtgctggctc gtcgcaaagc tcgcgagatc caggccaagc taaaggacca ggcagctaag gacaaggccc tgcagagcat ggctgccatg tcgtctgcac agatcatctc cgccacggcc ttccacagta gcatggccct cgcccggggc cccggccgcc cagcagtctc agggttttgg caaggagctt tgccaggcca agccggaacg tcccatgatg tgaagccttt ctctcagcaa acctatgctg tccagcctcc gctgcctctg ccagggtttg agtctcctgc agggcccgcc ccatcgccct ctgcgccccc ggcaccccca tggcagggcc gcagcgtggc cagctccaag ctctggatgt tggagttctc tgccttcctg gagcagcagc aggacccgga cacgtacaac aagcacctgt tcgtgcacat tggccagtcc agcccaagct acagcgaccc ctacctcgaa gccgtggaca tccgccaaat ctatgacaaa ttcccggaga aaaagggtgg actcaaggat ctcttcgaac ggggaccctc caatgccttt tttcttgtga agttctgggc agacctcaac accaacatcg aggatgaagg cagctccttc tatggggtct ccagccagta tgagagcccc gagaacatga tcatcacctg ctccacgaag gtctgctctt tcggcaagca ggtggtggag aaagttgaga cagagtatgc tcgctatgag aatggacact actcttaccg catccaccgg tccccgctct gtgagtacat gatcaacttc atccacaagc tcaagcacct ccctgagaag tacatgatga acagcgtgct ggagaacttc accatcctgc aggtggtcac caacagagac acacaggaga ccttgctgtg cattgcctat gtctttgagg tgtcagccag tgagcacggg gctcagcacc acatctacag gctggtgaaa gaatga. It is sometimes possible for the material contained within the vial of "TEAD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.