Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TDG cdna clone

TDG cDNA Clone

Gene Names
TDG; hTDG
Synonyms
TDG; TDG cDNA Clone; TDG cdna clone
Ordering
For Research Use Only!
Sequence
atggaagcggagaacgcgggcagctattcccttcagcaagctcaagctttttatacgtttccatttcaacaactgatggctgaagctcctaatatggcagttgtgaatgaacagcaaatgccagaagaagttccagccccagctcctgctcaggaaccagtgcaagaggctccaaaaggaagaaaaagaaaacccagaacaacagaaccaaaacaaccagtggaacccaaaaaacctgttgagtcaaaaaaatctggcaagtctgcaaaatcaaaagaaaaacaagaaaaaattacagacacatttaaagtaaaaagaaaagtagaccgttttaatggtgtttcagaagctgaacttctgaccaagactctccccgatattttgaccttcaatctggacattgtcattattggcataaacccgggactaatggctgcttacaaagggcatcattaccctggacctggaaaccatttttggaagtgtttgtttatgtcagggctcagtgaggtccagctgaaccatatggatgatcacactctaccagggaagtatggtattggatttaccaacatggtggaaaggaccacgcccggcagcaaagatctctccagtaaagaatttcgtgaaggaggacgtattctagtacagaaattacagaaatatcagccacgaatagcagtgtttaatggaaaatgtatttatgaaatttttagtaaagaagtttttggagtaaaggttaagaacttggaatttgggcttcagccccataagattccagacacagaaactctctgctatggtatgccatcatccagtgcaagatgtgctcagtttcctcgagcccaagacaaagttcattactacataaaactgaaggacttaagagatcagttgaaaggcattgaacgaaatatggacgttcaagaggtgcaatatacatttgacctacagcttgcccaagaggatgcaaagaagatggctgttaaggaagaaaaatatgatccaggttatgaggcagcatatggtggtgcttacggagaaaatccatgcagcagtgaaccttgtggcttctcttcaaatgggctaattgagagcgtggagttaagaggagaatcagctttcagtggcattcctaatgggcagtggatgacccagtcatttacagaccaaattccttcctttagtaatcactgtggaacacaagaacaggaagaagaaagccatgcttaa
Sequence Length
1233
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,053 Da
NCBI Official Full Name
Homo sapiens thymine-DNA glycosylase, mRNA
NCBI Official Synonym Full Names
thymine DNA glycosylase
NCBI Official Symbol
TDG
NCBI Official Synonym Symbols
hTDG
NCBI Protein Information
G/T mismatch-specific thymine DNA glycosylase
UniProt Protein Name
G/T mismatch-specific thymine DNA glycosylase
UniProt Gene Name
TDG
UniProt Synonym Gene Names
hTDG
UniProt Entry Name
TDG_HUMAN

NCBI Description

The protein encoded by this gene belongs to the TDG/mug DNA glycosylase family. Thymine-DNA glycosylase (TDG) removes thymine moieties from G/T mismatches by hydrolyzing the carbon-nitrogen bond between the sugar-phosphate backbone of DNA and the mispaired thymine. With lower activity, this enzyme also removes thymine from C/T and T/T mispairings. TDG can also remove uracil and 5-bromouracil from mispairings with guanine. This enzyme plays a central role in cellular defense against genetic mutation caused by the spontaneous deamination of 5-methylcytosine and cytosine. This gene may have a pseudogene in the p arm of chromosome 12. [provided by RefSeq, Jul 2008]

Uniprot Description

TDG: In the DNA of higher eukaryotes, hydrolytic deamination of 5-methylcytosine to thymine leads to the formation of G/T mismatches. This enzyme corrects G/T mispairs to G/C pairs. It is capable of hydrolyzing the carbon-nitrogen bond between the sugar- phosphate backbone of the DNA and a mispaired thymine. In addition to the G/T, it can remove thymine also from C/T and T/T mispairs in the order G/T >> C/T > T/T. It has no detectable activity on apyrimidinic sites and does not catalyze the removal of thymine from A/T pairs or from single-stranded DNA. It can also remove uracil and 5-bromouracil from mispairs with guanine. Belongs to the TDG/mug DNA glycosylase family.

Protein type: Nuclear receptor co-regulator; Hydrolase; DNA repair, damage; EC 3.2.2.29

Chromosomal Location of Human Ortholog: 12q24.1

Cellular Component: nucleoplasm; nucleus; plasma membrane

Molecular Function: damaged DNA binding; DNA N-glycosylase activity; double-stranded DNA binding; mismatched DNA binding; protein binding; protein homodimerization activity; pyrimidine-specific mismatch base pair DNA N-glycosylase activity; structure-specific DNA binding; uracil DNA N-glycosylase activity

Biological Process: base-excision repair; base-excision repair, AP site formation; depyrimidination; embryonic development; mismatch repair; protein sumoylation; regulation of gene expression, epigenetic

Research Articles on TDG

Similar Products

Product Notes

The TDG tdg (Catalog #AAA1268605) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcgg agaacgcggg cagctattcc cttcagcaag ctcaagcttt ttatacgttt ccatttcaac aactgatggc tgaagctcct aatatggcag ttgtgaatga acagcaaatg ccagaagaag ttccagcccc agctcctgct caggaaccag tgcaagaggc tccaaaagga agaaaaagaa aacccagaac aacagaacca aaacaaccag tggaacccaa aaaacctgtt gagtcaaaaa aatctggcaa gtctgcaaaa tcaaaagaaa aacaagaaaa aattacagac acatttaaag taaaaagaaa agtagaccgt tttaatggtg tttcagaagc tgaacttctg accaagactc tccccgatat tttgaccttc aatctggaca ttgtcattat tggcataaac ccgggactaa tggctgctta caaagggcat cattaccctg gacctggaaa ccatttttgg aagtgtttgt ttatgtcagg gctcagtgag gtccagctga accatatgga tgatcacact ctaccaggga agtatggtat tggatttacc aacatggtgg aaaggaccac gcccggcagc aaagatctct ccagtaaaga atttcgtgaa ggaggacgta ttctagtaca gaaattacag aaatatcagc cacgaatagc agtgtttaat ggaaaatgta tttatgaaat ttttagtaaa gaagtttttg gagtaaaggt taagaacttg gaatttgggc ttcagcccca taagattcca gacacagaaa ctctctgcta tggtatgcca tcatccagtg caagatgtgc tcagtttcct cgagcccaag acaaagttca ttactacata aaactgaagg acttaagaga tcagttgaaa ggcattgaac gaaatatgga cgttcaagag gtgcaatata catttgacct acagcttgcc caagaggatg caaagaagat ggctgttaag gaagaaaaat atgatccagg ttatgaggca gcatatggtg gtgcttacgg agaaaatcca tgcagcagtg aaccttgtgg cttctcttca aatgggctaa ttgagagcgt ggagttaaga ggagaatcag ctttcagtgg cattcctaat gggcagtgga tgacccagtc atttacagac caaattcctt cctttagtaa tcactgtgga acacaagaac aggaagaaga aagccatgct taa. It is sometimes possible for the material contained within the vial of "TDG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.