Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCHP cdna clone

TCHP cDNA Clone

Gene Names
TCHP; TpMs
Synonyms
TCHP; TCHP cDNA Clone; TCHP cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctcccgacgctgccgtcctactggtgcagccagcagcgcctgaatcagcagctagcacgacagcgagagcaggaggcccggcttcggcagcagtgggagcagaacagccgttacttcaggatgtctgacatctgcagctccaaacaggcagaatggagctctaaaacctcctaccagcggagcatgcatgcctatcagcgggagaagatgaaggaggagaagaggaggagtctggaggcccgacgggaaaagctcaggcagctcatgcaggaggagcaggacctgctggccagagaactggaggagctgaggctgagcatgaacttgcaggaaagaagaatccgggagcagcacgggaagctgaaatcagccaaagaagagcagaggaaactgattgctgaacaacttttgtacgaacactggaaaaagaacaacccgaaacttcgagagatggagctggaccttcaccagaagcatgtcgtaaactcttgggaaatgcagaaagaagaaaaaaaacagcaagaagccaccgcagagcaagagaacaaacggtatgaaaatgaatatgaaagggcccgaagggaggcgctagaaaggatgaaagctgaagaggagaggaggcagctggaggacaagctccaggccgaggcactgctgcaacagatggaggagctgaagctgaaggaggtggaggcgaccaaactaaagaaggagcaggagaatctgttgaagcagcggtgggagctagagaggctggaggaagagcgaaagcagatggaagccttccggcagaaggcagagctggggcgtttcttgagacatcagtataacgctcaactcagcagacgcacacagcagatccaagaggagctggaggcagacaggcggatcctgcaggccctcctcgagaaggaggacgagagccagcgcctccacctggccaggcgggagcaggtcatggccgatgtggcctggatgaagcaggccattgaggagcagctgcagctggagcgggcgcgggaggcagagctgcagatgctgctgagggaggaggccaaggagatgtgggaaaagagagaggcagagtgggcccgagagcgcagcgcacgggacagactgatgagcgaggttctgacagggagacaacagcaaatacaagagaagattgagcagaaccgacgggcacaagaggaatccctgaaacacagggagcaacttattcgaaatcttgaggaggtgagagagttggctcgtcgcgagaaagaggagagtgaaaagctgaaatcggccaggaagcaggagctggaagcccaggttgcagagcgccggctgcaggcatgggaagcagaccagcaggaggaggaggaagaggaggaggcccggcgggtcgagcagctctcagatgccctgctgcagcaggaggcggagactatggctgagcagggctaccggcctaagccttacggacatccaaaaattgcttggaactga
Sequence Length
1497
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,072 Da
NCBI Official Full Name
Homo sapiens trichoplein, keratin filament binding, mRNA
NCBI Official Synonym Full Names
trichoplein keratin filament binding
NCBI Official Symbol
TCHP
NCBI Official Synonym Symbols
TpMs
NCBI Protein Information
trichoplein keratin filament-binding protein
UniProt Protein Name
Trichoplein keratin filament-binding protein
UniProt Gene Name
TCHP
UniProt Synonym Gene Names
Protein TCHP; Mitostatin
UniProt Entry Name
TCHP_HUMAN

Uniprot Description

TCHP: Tumor suppressor which has the ability to inhibit cell growth and be pro-apoptotic during cell stress. Inhibits cell growth in bladder and prostate cancer cells by a down-regulation of HSPB1 by inhibiting its phosphorylation. May act as a 'capping' or 'branching' protein for keratin filaments in the cell periphery. May regulate K8/K18 filament and desmosome organization mainly at the apical or peripheral regions of simple epithelial cells. Belongs to the TCHP family.

Protein type: Tumor suppressor

Chromosomal Location of Human Ortholog: 12q24.11

Cellular Component: apical cortex; centrosome; cytoplasm; keratin filament; mitochondrion; plasma membrane

Molecular Function: protein binding

Biological Process: apoptosis; negative regulation of cell growth

Research Articles on TCHP

Similar Products

Product Notes

The TCHP tchp (Catalog #AAA1274271) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctcc cgacgctgcc gtcctactgg tgcagccagc agcgcctgaa tcagcagcta gcacgacagc gagagcagga ggcccggctt cggcagcagt gggagcagaa cagccgttac ttcaggatgt ctgacatctg cagctccaaa caggcagaat ggagctctaa aacctcctac cagcggagca tgcatgccta tcagcgggag aagatgaagg aggagaagag gaggagtctg gaggcccgac gggaaaagct caggcagctc atgcaggagg agcaggacct gctggccaga gaactggagg agctgaggct gagcatgaac ttgcaggaaa gaagaatccg ggagcagcac gggaagctga aatcagccaa agaagagcag aggaaactga ttgctgaaca acttttgtac gaacactgga aaaagaacaa cccgaaactt cgagagatgg agctggacct tcaccagaag catgtcgtaa actcttggga aatgcagaaa gaagaaaaaa aacagcaaga agccaccgca gagcaagaga acaaacggta tgaaaatgaa tatgaaaggg cccgaaggga ggcgctagaa aggatgaaag ctgaagagga gaggaggcag ctggaggaca agctccaggc cgaggcactg ctgcaacaga tggaggagct gaagctgaag gaggtggagg cgaccaaact aaagaaggag caggagaatc tgttgaagca gcggtgggag ctagagaggc tggaggaaga gcgaaagcag atggaagcct tccggcagaa ggcagagctg gggcgtttct tgagacatca gtataacgct caactcagca gacgcacaca gcagatccaa gaggagctgg aggcagacag gcggatcctg caggccctcc tcgagaagga ggacgagagc cagcgcctcc acctggccag gcgggagcag gtcatggccg atgtggcctg gatgaagcag gccattgagg agcagctgca gctggagcgg gcgcgggagg cagagctgca gatgctgctg agggaggagg ccaaggagat gtgggaaaag agagaggcag agtgggcccg agagcgcagc gcacgggaca gactgatgag cgaggttctg acagggagac aacagcaaat acaagagaag attgagcaga accgacgggc acaagaggaa tccctgaaac acagggagca acttattcga aatcttgagg aggtgagaga gttggctcgt cgcgagaaag aggagagtga aaagctgaaa tcggccagga agcaggagct ggaagcccag gttgcagagc gccggctgca ggcatgggaa gcagaccagc aggaggagga ggaagaggag gaggcccggc gggtcgagca gctctcagat gccctgctgc agcaggaggc ggagactatg gctgagcagg gctaccggcc taagccttac ggacatccaa aaattgcttg gaactga. It is sometimes possible for the material contained within the vial of "TCHP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.