Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCEB2 cdna clone

TCEB2 cDNA Clone

Gene Names
TCEB2; ELOB; SIII
Synonyms
TCEB2; TCEB2 cDNA Clone; TCEB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgtgttcctcatgatccggcgccacaagaccaccatcttcacggacgccaaggagtccagcacggtgttcgaactgaagcgcatcgtcgagggcatcctcaagcggcctcctgacgagcagcggctgtacaaggatgaccaactcttggatgatggcaagacactgggcgagtgtggcttcaccagtcaaacagcacggccacaggccccagccacagtggggctggccttccgggcagatgacacctttgaggccctgtgcatcgagccgttttccagcccgccagagctgcccgatgtgatgaagccccaggactcgggaagcagtgccaatgaacaagccgtgcagtga
Sequence Length
357
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,911 Da
NCBI Official Full Name
Homo sapiens transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B), mRNA
NCBI Official Synonym Full Names
transcription elongation factor B subunit 2
NCBI Official Symbol
TCEB2
NCBI Official Synonym Symbols
ELOB; SIII
NCBI Protein Information
transcription elongation factor B polypeptide 2
UniProt Protein Name
Transcription elongation factor B polypeptide 2
UniProt Gene Name
TCEB2
UniProt Synonym Gene Names
EloB
UniProt Entry Name
ELOB_HUMAN

NCBI Description

This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]

Uniprot Description

TCEB2: SIII, also known as elongin, is a general transcription elongation factor that increases the RNA polymerase II transcription elongation past template-encoded arresting sites. Subunit A is transcriptionally active and its transcription activity is strongly enhanced by binding to the dimeric complex of the SIII regulatory subunits B and C (elongin BC complex).

Protein type: Transcription, coactivator/corepressor; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 16p12.3

Cellular Component: Cul2-RING ubiquitin ligase complex; Cul5-RING ubiquitin ligase complex; cytosol; nucleoplasm; VCB complex

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: protein complex assembly; RNA elongation from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on TCEB2

Similar Products

Product Notes

The TCEB2 tceb2 (Catalog #AAA1276125) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgtgt tcctcatgat ccggcgccac aagaccacca tcttcacgga cgccaaggag tccagcacgg tgttcgaact gaagcgcatc gtcgagggca tcctcaagcg gcctcctgac gagcagcggc tgtacaagga tgaccaactc ttggatgatg gcaagacact gggcgagtgt ggcttcacca gtcaaacagc acggccacag gccccagcca cagtggggct ggccttccgg gcagatgaca cctttgaggc cctgtgcatc gagccgtttt ccagcccgcc agagctgccc gatgtgatga agccccagga ctcgggaagc agtgccaatg aacaagccgt gcagtga. It is sometimes possible for the material contained within the vial of "TCEB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.