Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBCD cdna clone

TBCD cDNA Clone

Gene Names
TBCD; tfcD; SSD-1
Synonyms
TBCD; TBCD cDNA Clone; TBCD cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgagcgacgaaccggccgcgggtggccccgaggaggaggcggaggacgagacactggcctttggcgcggcgctggaagcgttcggcgagagcgcggagacccgggcgctgctgggccgcctgcgggaggtgcacggcggcggcgcggagcgcgaggtggccctggagcggttccgcgtaataatggacaaataccaggagcagcctcatctgttggacccgcaccttgaatggatgatgaacttgttgttggacatagtgcaagatcagacatctccagcttcccttgtacatctggcttttaaatttctttacatcatcaccaaggttcgaggctataaaacatttcttcgtttatttcctcatgaagttgccgatgtagagcctgttttagatttggtcacaattcagaatcccaaggaccatgaagcttgggaaacccgctacatgcttttgctctggctctccgtgacctgcctgatcccttttgatttttctcgccttgacgggaacctcctcacccagcctgggcaagcacgaatgtccataatggaccgtattctccaaatagcagagtcctacttgattgtcagtgacaaggcccgagatgcagctgctgtccttgtgtccagatttatcacacgtcctgatgtcaagcaaagcaagatggctgagttcctggactggagcctgtgcaatctggcccgttcctccttccagaccatgcagggggtcatcaccatggatgggacgctgcaggccctggcacaaatatttaaacatggaaaacgtgaagactgtttgccctatgctgccactgtcctcaggtgcctcgatggctgcagactccctgagagcaaccagaccctgctgcggaagctgggggtgaagcttgtgcagcgactggggctgacattcctgaagccgaaggtggcagcatggaggtaccagcgtggctgccgatctttggctgcaaatctgcagctcctcactcagggtcagagtgagcagaagccactcatcctgaccgaagatgacgacgaagatgacgacgtcccagagggggtggagcgtgtgatagagcagctgctggtcgggctgaaggacaaggacacggtcgtgcggtggtctgcagccaagggcatcggtaggatggctggcaggcttcccagagccctggcggatgatgtggtcgggtctgtgctggactgcttcagtttccaggagactgacaaggcgtggcatgggggatgtctggcgctggcagagctgggcaggagaggcctgttgctgccgtctcgactcgtggatgttgtcgccgtgatcctgaaggcgctgacctacgacgagaagcggggtgcctgcagcgtgggcaccaacgtcagggacgccgcctgctacgtgtgctgggccttcgcgcgtgcctatgagcctcaggagctgaagccctttgtgactgcaatctcgagtgcactggtgattgctgcggtgtttgaccgagacataaactgcagaagagcagcctctgccgccttccaggagaatgtggggagacagggcactttccctcatggtattgatattttgaccacagctgactattttgccgtcggtaacagatccaactgtttcctggttataagtgtgtttattgccggctttcctgagtacacgcagccaatgatagaccacctggttaccatgaagatcagccactgggatggggtcatccgagagttggctgcgagggcgctgcacaacctggcccagcaggcacccgagttcagcgccacgcaagtcttcccgaggctgctgtccatgacactgagtccagatcttcacatgaggcatgggtcgattctcgcctgcgcagaagttgcttacgccttgtacaaacttgcagcccaagagaacaggcccgtcacggaccatctggacgagcaggcagtgcagggcctgaagcagattcaccagcagctctatgatcgtcagttatacaggggtctgggaggacagctcatgagacaagcagtgtgtgttttaatagaaaagttgtcactttccaaaatgccctttagaggtgacaccgtaattgatggttggcaatggctgataaatgactcgctgtggcttctcgttggccttgggcgcccttccaggcttccttctgaaaggccggctccagcaggttctcacaggtttaagagcagttacccacacttcccccgaggacgtaagttttgctga
Sequence Length
2253
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,263 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor D, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor D
NCBI Official Symbol
TBCD
NCBI Official Synonym Symbols
tfcD; SSD-1
NCBI Protein Information
tubulin-specific chaperone D
UniProt Protein Name
Tubulin-specific chaperone D
UniProt Gene Name
TBCD
UniProt Synonym Gene Names
KIAA0988; SSD1; TFCD; tfcD
UniProt Entry Name
TBCD_HUMAN

NCBI Description

Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Uniprot Description

TBCD: Tubulin-folding protein; involved in the first step of the tubulin folding pathway. Modulates microtubule dynamics by capturing GTP-bound beta-tubulin (TUBB). Acts as a GTPase- activating protein (GAP) for ARL2. Its ability to interact with beta tubulin is regulated via its interaction with ARL2. Induces microtubule disruption in absence of ARL2. Increases degradation of beta tubulin, when overexpressed in polarized cells. Promotes epithelial cell detachment, a process antagonized by ARL2. Induces tight adherens and tight junctions disassembly at the lateral cell membrane. Belongs to the TBCD family. 5 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: adherens junction; lateral plasma membrane; microtubule; tight junction

Molecular Function: beta-tubulin binding; chaperone binding; GTPase activator activity; protein binding

Biological Process: negative regulation of microtubule polymerization; post-chaperonin tubulin folding pathway; protein folding; tubulin folding

Research Articles on TBCD

Similar Products

Product Notes

The TBCD tbcd (Catalog #AAA1278683) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctga gcgacgaacc ggccgcgggt ggccccgagg aggaggcgga ggacgagaca ctggcctttg gcgcggcgct ggaagcgttc ggcgagagcg cggagacccg ggcgctgctg ggccgcctgc gggaggtgca cggcggcggc gcggagcgcg aggtggccct ggagcggttc cgcgtaataa tggacaaata ccaggagcag cctcatctgt tggacccgca ccttgaatgg atgatgaact tgttgttgga catagtgcaa gatcagacat ctccagcttc ccttgtacat ctggctttta aatttcttta catcatcacc aaggttcgag gctataaaac atttcttcgt ttatttcctc atgaagttgc cgatgtagag cctgttttag atttggtcac aattcagaat cccaaggacc atgaagcttg ggaaacccgc tacatgcttt tgctctggct ctccgtgacc tgcctgatcc cttttgattt ttctcgcctt gacgggaacc tcctcaccca gcctgggcaa gcacgaatgt ccataatgga ccgtattctc caaatagcag agtcctactt gattgtcagt gacaaggccc gagatgcagc tgctgtcctt gtgtccagat ttatcacacg tcctgatgtc aagcaaagca agatggctga gttcctggac tggagcctgt gcaatctggc ccgttcctcc ttccagacca tgcagggggt catcaccatg gatgggacgc tgcaggccct ggcacaaata tttaaacatg gaaaacgtga agactgtttg ccctatgctg ccactgtcct caggtgcctc gatggctgca gactccctga gagcaaccag accctgctgc ggaagctggg ggtgaagctt gtgcagcgac tggggctgac attcctgaag ccgaaggtgg cagcatggag gtaccagcgt ggctgccgat ctttggctgc aaatctgcag ctcctcactc agggtcagag tgagcagaag ccactcatcc tgaccgaaga tgacgacgaa gatgacgacg tcccagaggg ggtggagcgt gtgatagagc agctgctggt cgggctgaag gacaaggaca cggtcgtgcg gtggtctgca gccaagggca tcggtaggat ggctggcagg cttcccagag ccctggcgga tgatgtggtc gggtctgtgc tggactgctt cagtttccag gagactgaca aggcgtggca tgggggatgt ctggcgctgg cagagctggg caggagaggc ctgttgctgc cgtctcgact cgtggatgtt gtcgccgtga tcctgaaggc gctgacctac gacgagaagc ggggtgcctg cagcgtgggc accaacgtca gggacgccgc ctgctacgtg tgctgggcct tcgcgcgtgc ctatgagcct caggagctga agccctttgt gactgcaatc tcgagtgcac tggtgattgc tgcggtgttt gaccgagaca taaactgcag aagagcagcc tctgccgcct tccaggagaa tgtggggaga cagggcactt tccctcatgg tattgatatt ttgaccacag ctgactattt tgccgtcggt aacagatcca actgtttcct ggttataagt gtgtttattg ccggctttcc tgagtacacg cagccaatga tagaccacct ggttaccatg aagatcagcc actgggatgg ggtcatccga gagttggctg cgagggcgct gcacaacctg gcccagcagg cacccgagtt cagcgccacg caagtcttcc cgaggctgct gtccatgaca ctgagtccag atcttcacat gaggcatggg tcgattctcg cctgcgcaga agttgcttac gccttgtaca aacttgcagc ccaagagaac aggcccgtca cggaccatct ggacgagcag gcagtgcagg gcctgaagca gattcaccag cagctctatg atcgtcagtt atacaggggt ctgggaggac agctcatgag acaagcagtg tgtgttttaa tagaaaagtt gtcactttcc aaaatgccct ttagaggtga caccgtaatt gatggttggc aatggctgat aaatgactcg ctgtggcttc tcgttggcct tgggcgccct tccaggcttc cttctgaaag gccggctcca gcaggttctc acaggtttaa gagcagttac ccacacttcc cccgaggacg taagttttgc tga. It is sometimes possible for the material contained within the vial of "TBCD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.