Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBCB cdna clone

TBCB cDNA Clone

Gene Names
TBCB; CG22; CKAP1; CKAPI
Synonyms
TBCB; TBCB cDNA Clone; TBCB cdna clone
Ordering
For Research Use Only!
Sequence
atggaggtgacgggggtgtcggcacccacggtgaccgttttcatcagcagctccctcaacaccttccgctccgagaagcgatacagccgcagcctcaccatcgctgagttcaagtgtaaactggagttgctggtgggcagccctgcttcctgcatggaactggagctgtatggagttgacgacaagttctacagcaagctggatcaagaggatgcgctcctgggctcctaccctgtagatgacggctgccgcatccacgtcattgaccacagtggcgcccgccttggtgagtatgaggacgtgtcccgggtggagaagtacacgatctcacaagaagcctacgaccagaggcaagacacggtccgctctttcctgaagcgcagcaagctcggccggtacaacgaggaggagcgggctcagcaggaggccgaggccgcccagcgcctggccgaggagaaggcccaggccagctccatccccgtgggcagccgctgtgaggtgcgggcggcgggacaatcccctcgccggggcaccgtcatgtatgtaggtctcacagatttcaagcctggctactggattggtgtccgctatgatgagccactggggaaaaatgatggcagtgtgaatgggaaacgctacttcgaatgccaggccaagtatggcgcctttgtcaagccagcagtcgtgacggtgggggacttcccggaggaggactacgggttggacgagatatga
Sequence Length
735
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,801 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor B, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor B
NCBI Official Symbol
TBCB
NCBI Official Synonym Symbols
CG22; CKAP1; CKAPI
NCBI Protein Information
tubulin-folding cofactor B
UniProt Protein Name
Tubulin-folding cofactor B
UniProt Gene Name
TBCB
UniProt Synonym Gene Names
CG22; CKAP1
UniProt Entry Name
TBCB_HUMAN

Uniprot Description

TBCB: a cytoskeletal protein that binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway leading from newly synthesized tubulin to properly folded heterodimer.

Protein type: Cytoskeletal; Chaperone; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.11-q13.12

Cellular Component: cytoplasm; microtubule cytoskeleton; nucleoplasm

Molecular Function: protein binding

Research Articles on TBCB

Similar Products

Product Notes

The TBCB tbcb (Catalog #AAA1267268) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggtga cgggggtgtc ggcacccacg gtgaccgttt tcatcagcag ctccctcaac accttccgct ccgagaagcg atacagccgc agcctcacca tcgctgagtt caagtgtaaa ctggagttgc tggtgggcag ccctgcttcc tgcatggaac tggagctgta tggagttgac gacaagttct acagcaagct ggatcaagag gatgcgctcc tgggctccta ccctgtagat gacggctgcc gcatccacgt cattgaccac agtggcgccc gccttggtga gtatgaggac gtgtcccggg tggagaagta cacgatctca caagaagcct acgaccagag gcaagacacg gtccgctctt tcctgaagcg cagcaagctc ggccggtaca acgaggagga gcgggctcag caggaggccg aggccgccca gcgcctggcc gaggagaagg cccaggccag ctccatcccc gtgggcagcc gctgtgaggt gcgggcggcg ggacaatccc ctcgccgggg caccgtcatg tatgtaggtc tcacagattt caagcctggc tactggattg gtgtccgcta tgatgagcca ctggggaaaa atgatggcag tgtgaatggg aaacgctact tcgaatgcca ggccaagtat ggcgcctttg tcaagccagc agtcgtgacg gtgggggact tcccggagga ggactacggg ttggacgaga tatga. It is sometimes possible for the material contained within the vial of "TBCB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.