Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAF9 cdna clone

TAF9 cDNA Clone

Gene Names
TAF9; TAF2G; TAFII31; TAFII32; MGC:5067; TAFII-31; TAFII-32; TAFIID32; STAF31/32
Synonyms
TAF9; TAF9 cDNA Clone; TAF9 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtctggcaagacggcttctcccaagagcatgccgaaagatgcacagatgatggcacaaatcctgaaggatatggggattacagaatatgagccaagagttataaatcagatgttggagtttgccttccgatatgtgaccacaattctagatgatgcaaaaatttattcaagccatgctaagaaagctactgttgatgcagatgatgtgcgattggcaatccagtgccgcgctgatcagtcttttacctctcctcccccaagagattttttattagatattgcaaggcaaagaaatcaaacccctttgccattgatcaagccatattcaggtcctaggttgccacctgatagatactgcttaacagctccaaactataggctgaaatctttacagaaaaaggcatcaacttctgcgggaagaataacagtcccgcggttaagtgttggttcagttactagcagaccaagtactcccacactaggcacaccaaccccacagaccatgtctgtttcaactaaagtagggactcccatgtccctcacaggtcaaaggtttacagtacagatgcctacttctcagtctccagctgtaaaagcttcaattcctgcaacctcagcagttcagaatgttctgattaatccatcattaatcgggtccaaaaacatttttattaccactaatatgatgtcatcacaaaatactgccaatgaatcatcaaatgcattgaaaagaaaacgtgaagatgatgatgatgacgatgatgatgatgatgactatgataatctgtaa
Sequence Length
795
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,974 Da
NCBI Official Full Name
Homo sapiens TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein associated factor 9
NCBI Official Symbol
TAF9
NCBI Official Synonym Symbols
TAF2G; TAFII31; TAFII32; MGC:5067; TAFII-31; TAFII-32; TAFIID32; STAF31/32
NCBI Protein Information
transcription initiation factor TFIID subunit 9
UniProt Protein Name
Transcription initiation factor TFIID subunit 9
UniProt Gene Name
TAF9
UniProt Synonym Gene Names
TAF2G; TAFII31; TAFII-31; TAFII31; TAFII-32; TAFII32
UniProt Entry Name
TAF9_HUMAN

NCBI Description

Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

TAFII31: a component of the transcription factor IID (TFIID) complex, PCAF histone acetylase complex and TBP-free TAFII complex (TFTC). TIIFD is essential for mediating regulation of RNA polymerase transcription. TAFII31 binds to p53, the basal transcription factor GTF2B, and the acidic transactivator viral protein 16 (VP16). It is a coactivator for P53.

Protein type: Transcription initiation complex

Chromosomal Location of Human Ortholog: 5q13.2

Cellular Component: nucleoplasm; PCAF complex; transcription factor TFIID complex

Molecular Function: ATPase binding; DNA binding; histone acetyltransferase activity; p53 binding; protein binding; transcription activator binding; transcription coactivator activity

Biological Process: box C/D snoRNP assembly; negative regulation of apoptosis; negative regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of cell growth; positive regulation of transcription from RNA polymerase II promoter; protein stabilization; response to DNA damage stimulus; RNA elongation from RNA polymerase II promoter; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on TAF9

Similar Products

Product Notes

The TAF9 taf9 (Catalog #AAA1275998) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtctg gcaagacggc ttctcccaag agcatgccga aagatgcaca gatgatggca caaatcctga aggatatggg gattacagaa tatgagccaa gagttataaa tcagatgttg gagtttgcct tccgatatgt gaccacaatt ctagatgatg caaaaattta ttcaagccat gctaagaaag ctactgttga tgcagatgat gtgcgattgg caatccagtg ccgcgctgat cagtctttta cctctcctcc cccaagagat tttttattag atattgcaag gcaaagaaat caaacccctt tgccattgat caagccatat tcaggtccta ggttgccacc tgatagatac tgcttaacag ctccaaacta taggctgaaa tctttacaga aaaaggcatc aacttctgcg ggaagaataa cagtcccgcg gttaagtgtt ggttcagtta ctagcagacc aagtactccc acactaggca caccaacccc acagaccatg tctgtttcaa ctaaagtagg gactcccatg tccctcacag gtcaaaggtt tacagtacag atgcctactt ctcagtctcc agctgtaaaa gcttcaattc ctgcaacctc agcagttcag aatgttctga ttaatccatc attaatcggg tccaaaaaca tttttattac cactaatatg atgtcatcac aaaatactgc caatgaatca tcaaatgcat tgaaaagaaa acgtgaagat gatgatgatg acgatgatga tgatgatgac tatgataatc tgtaa. It is sometimes possible for the material contained within the vial of "TAF9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.