Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYVN1 cdna clone

SYVN1 cDNA Clone

Gene Names
SYVN1; DER3; HRD1
Synonyms
SYVN1; SYVN1 cDNA Clone; SYVN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttccgcacggcagtgatgatggcggccagcctggcgctgaccggggctgtggtggctcacgcctactacctcaaacaccagttctaccccactgtggtgtacctgaccaagtccagccccagcatggcagtcctgtacatccaggcctttgtccttgtcttccttctgggcaaggtgatgggcaaggtgttctttgggcaactgagggcagcagagatggagcaccttctggaacgttcctggtacgccgtcacagagacttgtctggccttcaccgtttttcgggatgacttcagcccccgctttgttgcactcttcactcttcttctcttcctcaaatgtttccactggctggctgaggaccgtgtggactttatggaacgcagccccaacatctcctggctctttcactgccgcattgtctctcttatgttcctcctgggcatcctggacttcctcttcgtcagccacgcctatcacagcatcctgacccgtggggcctctgtgcagctggtgtttggctttgagtatgccatcctgatgacgatggtgctcaccatcttcatcaagtatgtgctgcactccgtggacctccagagtgagaacccctgggacaacaaggctgtgtacatgctctacacagagctgtttacaggcttcatcaaggttctgctgtacatggccttcatgaccatcatgatcaaggtgcacaccttcccactctttgccatccggcccatgtacctggccatgagacagttcaagaaagctgtgacagatgccatcatgtctcgccgagccatccgcaacatgaacaccctgtatccagatgccaccccagaggagctccaggcaatggacaatgtctgcatcatctgccgagaagagatggtgactggtgccaagagactgccctgcaaccacattttccataccagctgcctgcgctcctggttccagcggcagcagacctgccccacctgccgtatggatgtccttcgtgcatcgctgccagcgcagtcaccaccacccccggagcctgcggatcaggggccaccccctgccccccaccccccaccactcttgcctcagccccccaacttcccccagggcctcctgcctccttttcctccaggcatgttcccactgtggccccccatgggcccctttccacctgtcccgcctccccccagctcaggagaggctgtggctcctccatccaccagtgcagcagccctttctcggcccagtggagcagctacaaccacagctgctggcaccagtgctactgctgcttctgccacagcatctggcccaggctctggctctgccccagaggctggccctgcccctggtttccccttccctcctccctggatgggtatgcccctgcctccaccctttgccttccccccaatgcctgtgccccctgcgggctttgctgggctgaccccagaggagctacgagctctggagggccatgagcggcagcacctggaggcccggctgcagagcctgcgtaacatccacacactgctggacgccgccatgctgcagatcaaccagtacctcaccgtgctggcctccttggggcccccccggcctgccacttcagtcaactccactgaggagactgccactacagttgttgctgctgcctcctccaccagcatccctagctcagaggccacgaccccaaccccaggagcctccccaccagcccctgaaatggaaaggcctccagctcctgagtcagtgggcacagaggagatgcctgaggatggagagcccgatgcagcagagctccgccggcgccgcctgcagaagctggagtctcctgttgcccactga
Sequence Length
1854
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,614 Da
NCBI Official Full Name
Homo sapiens synovial apoptosis inhibitor 1, synoviolin, mRNA
NCBI Official Synonym Full Names
synoviolin 1
NCBI Official Symbol
SYVN1
NCBI Official Synonym Symbols
DER3; HRD1
NCBI Protein Information
E3 ubiquitin-protein ligase synoviolin
UniProt Protein Name
E3 ubiquitin-protein ligase synoviolin
UniProt Gene Name
SYVN1
UniProt Synonym Gene Names
HRD1; KIAA1810
UniProt Entry Name
SYVN1_HUMAN

NCBI Description

This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms. [provided by RefSeq, May 2011]

Uniprot Description

SYVN1: Acts as an E3 ubiquitin-protein ligase which accepts ubiquitin specifically from endoplasmic reticulum-associated UBC7 E2 ligase and transfers it to substrates, promoting their degradation. Component of the endoplasmic reticulum quality control (ERQC) system also called ER-associated degradation (ERAD) involved in ubiquitin-dependent degradation of misfolded endoplasmic reticulum proteins. Also promotes the degradation of normal but naturally short-lived proteins such as SGK. Protects cells from ER stress-induced apoptosis. Protects neurons from apoptosis induced by polyglutamine-expanded huntingtin (HTT) or unfolded GPR37 by promoting their degradation. Sequesters p53/TP53 in the cytoplasm and promotes its degradation, thereby negatively regulating its biological function in transcription, cell cycle regulation and apoptosis. Belongs to the HRD1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ligase; EC 6.3.2.-; Ubiquitin conjugating system; Membrane protein, multi-pass; Ubiquitin ligase; Membrane protein, integral; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane; nucleoplasm; smooth endoplasmic reticulum

Molecular Function: ATPase binding; chaperone binding; protein binding; unfolded protein binding

Biological Process: ER-associated protein catabolic process; protein amino acid N-linked glycosylation via asparagine; protein stabilization; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; retrograde protein transport, ER to cytosol; unfolded protein response

Research Articles on SYVN1

Similar Products

Product Notes

The SYVN1 syvn1 (Catalog #AAA1270951) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccgca cggcagtgat gatggcggcc agcctggcgc tgaccggggc tgtggtggct cacgcctact acctcaaaca ccagttctac cccactgtgg tgtacctgac caagtccagc cccagcatgg cagtcctgta catccaggcc tttgtccttg tcttccttct gggcaaggtg atgggcaagg tgttctttgg gcaactgagg gcagcagaga tggagcacct tctggaacgt tcctggtacg ccgtcacaga gacttgtctg gccttcaccg tttttcggga tgacttcagc ccccgctttg ttgcactctt cactcttctt ctcttcctca aatgtttcca ctggctggct gaggaccgtg tggactttat ggaacgcagc cccaacatct cctggctctt tcactgccgc attgtctctc ttatgttcct cctgggcatc ctggacttcc tcttcgtcag ccacgcctat cacagcatcc tgacccgtgg ggcctctgtg cagctggtgt ttggctttga gtatgccatc ctgatgacga tggtgctcac catcttcatc aagtatgtgc tgcactccgt ggacctccag agtgagaacc cctgggacaa caaggctgtg tacatgctct acacagagct gtttacaggc ttcatcaagg ttctgctgta catggccttc atgaccatca tgatcaaggt gcacaccttc ccactctttg ccatccggcc catgtacctg gccatgagac agttcaagaa agctgtgaca gatgccatca tgtctcgccg agccatccgc aacatgaaca ccctgtatcc agatgccacc ccagaggagc tccaggcaat ggacaatgtc tgcatcatct gccgagaaga gatggtgact ggtgccaaga gactgccctg caaccacatt ttccatacca gctgcctgcg ctcctggttc cagcggcagc agacctgccc cacctgccgt atggatgtcc ttcgtgcatc gctgccagcg cagtcaccac cacccccgga gcctgcggat caggggccac cccctgcccc ccacccccca ccactcttgc ctcagccccc caacttcccc cagggcctcc tgcctccttt tcctccaggc atgttcccac tgtggccccc catgggcccc tttccacctg tcccgcctcc ccccagctca ggagaggctg tggctcctcc atccaccagt gcagcagccc tttctcggcc cagtggagca gctacaacca cagctgctgg caccagtgct actgctgctt ctgccacagc atctggccca ggctctggct ctgccccaga ggctggccct gcccctggtt tccccttccc tcctccctgg atgggtatgc ccctgcctcc accctttgcc ttccccccaa tgcctgtgcc ccctgcgggc tttgctgggc tgaccccaga ggagctacga gctctggagg gccatgagcg gcagcacctg gaggcccggc tgcagagcct gcgtaacatc cacacactgc tggacgccgc catgctgcag atcaaccagt acctcaccgt gctggcctcc ttggggcccc cccggcctgc cacttcagtc aactccactg aggagactgc cactacagtt gttgctgctg cctcctccac cagcatccct agctcagagg ccacgacccc aaccccagga gcctccccac cagcccctga aatggaaagg cctccagctc ctgagtcagt gggcacagag gagatgcctg aggatggaga gcccgatgca gcagagctcc gccggcgccg cctgcagaag ctggagtctc ctgttgccca ctga. It is sometimes possible for the material contained within the vial of "SYVN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.