SYTL4 cdna clone
SYTL4 cDNA Clone
Gene Names
SYTL4; SLP4
Synonyms
SYTL4; SYTL4 cDNA Clone; SYTL4 cdna clone
Sequence
atgtcggagttactggacctttcttttctgtctgaggaggaaaaggatttgattctcagtgttctacagcgagatgaagaggtccggaaagcagatgagaaaaggattaggcgactaaagaatgagttactggagataaaaaggaaaggggccaagaggggcagccaacactacagtgatcggacctgtgcccggtgccaggagagcctgggccgtttgagtcccaaaaccaatacttgtcggggttgtaatcacctggtgtgtcgggactgccgcatacaggaaagcaatggtacctggaggtgcaaggtgtgcgccaaggaaatagagttgaagaaagcaactggggactggttttatgaccagaaagtgaatcgctttgcttaccgcacaggtagtgagataatcaggatgtccctgcgccacaaacctgcagtgagtaaaagagagacagtgggacagtccctccttcatcagacacagatgggtgacatctggccaggaagaaagatcattcaggagcggcagaaggagcccagtgtgctatttgaagtgccaaagctgaaaagtggaaagagtgcattggaagctgagagtgagagtctggatagcttcacagctgactcggatagcacctccaggagagactctctggataaatctggcctctttccagaatggaagaagatgtctgctcccaaatctcaagtagaaaaggaaactcagcctggaggtcaaaatgtggtatttgtggatgagggtgagatgatatttaagaagaacaccagaaaaatcctcaggccttcagagtacactaaatctgtgatagatcttcgcccagaagatgtggtacatgaaagtggctccttgggagacagaagcaaatccgtcccaggcctcaatgtggatatggaagaggaagaagaagaagaagacattgaccacctagtgaagttacatcgccagaagctagccagaagcagcatgcaaagtggctcctccatgagtacgatcggcagcatgatgagcatctacagtgaagctggtgatttcgggaacatctttgtgactggcaggattgccttttccctgaagtatgagcagcaaacccagagtctggttgtccatgtgaaggagtgccatcagctggcctatgctgatgaagccaagaagcgctctaacccatatgtgaagacttaccttctgcctgacaagtcccgccaaggaaaaagaaaaaccagcatcaagcgggacactgttaatccactatatgatgagacgctgaggtatgagatcccagaatctctcctggcccagaggaccctgcagttctcagtttggcatcatggtcgttttggcagaaacactttccttggagaggcagagatccagatggattcctggaagcttgataagaaactggatcattgcctccctttacatggaaagatcagtgctgagtccccgactggcttgccatcacacaaaggcgagttggtggtttcattgaaatacatcccagcctccaaaacccctgttggaggtgaccggaaaaagagtaaaggtggggaagggggagagctccaggtgtggatcaaagaagccaagaacttgacggctgccaaagcaggagggacttcagacagctttgtcaagggatacctccttcccatgaggaacaaggccagtaaacgtaaaactcctgtgatgaagaagaccctgaatcctcactacaaccatacatttgtctacaatggtgtgaggctggaagatctacagcatatgtgcctggaactgactgtgtgggaccgggagcccctggccagcaatgacttcctgggaggggtcaggctgggtgttggcactgggatcagtaatggggaagtggtggactggatggactcgactggggaagaagtgagcctgtggcagaagatgcgacagtacccagggtcttgggcagaagggactctgcagctccgttcctcaatggccaagcagaagctgggtttatga
Sequence Length
2016
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,813 Da
NCBI Official Full Name
Homo sapiens synaptotagmin-like 4, mRNA
NCBI Official Synonym Full Names
synaptotagmin like 4
NCBI Official Symbol
SYTL4
NCBI Official Synonym Symbols
SLP4
NCBI Protein Information
synaptotagmin-like protein 4
UniProt Protein Name
Synaptotagmin-like protein 4
Protein Family
UniProt Gene Name
SYTL4
UniProt Entry Name
SYTL4_HUMAN
NCBI Description
This gene encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in intracellular membrane trafficking. This protein binds Rab27 and may be involved in inhibiting dense core vesicle exocytosis. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Mar 2010]
Uniprot Description
SYTL4: Modulates exocytosis of dense-core granules and secretion of hormones in the pancreas and the pituitary. Interacts with vesicles containing negatively charged phospholipids in a Ca(2+)-independent manner. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Vesicle
Chromosomal Location of Human Ortholog: Xq21.33
Cellular Component: centrosome; cytoplasm; endosome; extrinsic to membrane; nucleoplasm; plasma membrane
Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; neurexin binding; phospholipid binding; protein binding; syntaxin binding
Biological Process: calcium ion-dependent exocytosis of neurotransmitter; positive regulation of exocytosis; positive regulation of protein secretion; regulation of calcium ion-dependent exocytosis; vesicle fusion
Research Articles on SYTL4
Similar Products
Product Notes
The SYTL4 sytl4 (Catalog #AAA1270854) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagt tactggacct ttcttttctg tctgaggagg aaaaggattt gattctcagt gttctacagc gagatgaaga ggtccggaaa gcagatgaga aaaggattag gcgactaaag aatgagttac tggagataaa aaggaaaggg gccaagaggg gcagccaaca ctacagtgat cggacctgtg cccggtgcca ggagagcctg ggccgtttga gtcccaaaac caatacttgt cggggttgta atcacctggt gtgtcgggac tgccgcatac aggaaagcaa tggtacctgg aggtgcaagg tgtgcgccaa ggaaatagag ttgaagaaag caactgggga ctggttttat gaccagaaag tgaatcgctt tgcttaccgc acaggtagtg agataatcag gatgtccctg cgccacaaac ctgcagtgag taaaagagag acagtgggac agtccctcct tcatcagaca cagatgggtg acatctggcc aggaagaaag atcattcagg agcggcagaa ggagcccagt gtgctatttg aagtgccaaa gctgaaaagt ggaaagagtg cattggaagc tgagagtgag agtctggata gcttcacagc tgactcggat agcacctcca ggagagactc tctggataaa tctggcctct ttccagaatg gaagaagatg tctgctccca aatctcaagt agaaaaggaa actcagcctg gaggtcaaaa tgtggtattt gtggatgagg gtgagatgat atttaagaag aacaccagaa aaatcctcag gccttcagag tacactaaat ctgtgataga tcttcgccca gaagatgtgg tacatgaaag tggctccttg ggagacagaa gcaaatccgt cccaggcctc aatgtggata tggaagagga agaagaagaa gaagacattg accacctagt gaagttacat cgccagaagc tagccagaag cagcatgcaa agtggctcct ccatgagtac gatcggcagc atgatgagca tctacagtga agctggtgat ttcgggaaca tctttgtgac tggcaggatt gccttttccc tgaagtatga gcagcaaacc cagagtctgg ttgtccatgt gaaggagtgc catcagctgg cctatgctga tgaagccaag aagcgctcta acccatatgt gaagacttac cttctgcctg acaagtcccg ccaaggaaaa agaaaaacca gcatcaagcg ggacactgtt aatccactat atgatgagac gctgaggtat gagatcccag aatctctcct ggcccagagg accctgcagt tctcagtttg gcatcatggt cgttttggca gaaacacttt ccttggagag gcagagatcc agatggattc ctggaagctt gataagaaac tggatcattg cctcccttta catggaaaga tcagtgctga gtccccgact ggcttgccat cacacaaagg cgagttggtg gtttcattga aatacatccc agcctccaaa acccctgttg gaggtgaccg gaaaaagagt aaaggtgggg aagggggaga gctccaggtg tggatcaaag aagccaagaa cttgacggct gccaaagcag gagggacttc agacagcttt gtcaagggat acctccttcc catgaggaac aaggccagta aacgtaaaac tcctgtgatg aagaagaccc tgaatcctca ctacaaccat acatttgtct acaatggtgt gaggctggaa gatctacagc atatgtgcct ggaactgact gtgtgggacc gggagcccct ggccagcaat gacttcctgg gaggggtcag gctgggtgtt ggcactggga tcagtaatgg ggaagtggtg gactggatgg actcgactgg ggaagaagtg agcctgtggc agaagatgcg acagtaccca gggtcttggg cagaagggac tctgcagctc cgttcctcaa tggccaagca gaagctgggt ttatga. It is sometimes possible for the material contained within the vial of "SYTL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
