Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYTL2 cdna clone

SYTL2 cDNA Clone

Gene Names
SYTL2; EXO4; SLP2; SLP2A; SGA72M; CHR11SYT; PPP1R151
Synonyms
SYTL2; SYTL2 cDNA Clone; SYTL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaagtctgttccagcatttctccaagatgagagtgatgacagagaaacagatacagcatcagaaagcagttaccagctcagcagacacaagaagagcccgagctctttaaccaatcttagcagctcctctggcatgacgtccttgtcttctgtgagtggcagtgtgatgagtgtttatagtggagactttggcaatctggaagttaaaggaaatattcagtttgcaattgaatatgtggagtcactgaaggagttgcatgtttttgtggcccagtgtaaggacttagcagcagcggatgtaaaaaaacagcgttcagacccatatgtaaaggcctatttgctaccagacaaaggcaaaatgggcaagaagaaaacactcgtagtgaagaaaaccttgaatcctgtgtataacgaaatactgcggtataaaattgaaaaacaaatcttaaagacacagaaattgaacctgtccatttggcatcgggatacatttaagcgcaatagtttcctaggggaggtggaacttgatttggaaacatgggactgggataacaaacagaataaacaattgagatggtaccctctgaagcggaagacagcaccagttgcccttgaagcagaaaacagaggtgaaatgaaactagctctccagtatgtcccagagccagtccctggtaaaaagcttcctacaactggagaagtgcacatctgggtgaaggaatgccttgatctaccactgctaaggggaagtcatctaaattcttttgttaaatgtaccatccttccagatacaagtaggaaaagtcgccagaagacaagagctgtagggaaaaccaccaaccctatcttcaaccacactatggtgtatgatgggttcaggcctgaagatctgatggaagcctgtgtagagcttactgtctgggaccattacaaattaaccaaccaatttttgggaggtcttcgtattggctttggaacaggtaaaagttatgggactgaagtggactggatggactctacttcagaggaagttgctctctgggagaagatggtaaactcccccaatacttggattgaagcaacactgcctctcagaatgcttttgattgccaagatttccaaatga
Sequence Length
1131
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,651 Da
NCBI Official Full Name
Homo sapiens synaptotagmin-like 2, mRNA
NCBI Official Synonym Full Names
synaptotagmin like 2
NCBI Official Symbol
SYTL2
NCBI Official Synonym Symbols
EXO4; SLP2; SLP2A; SGA72M; CHR11SYT; PPP1R151
NCBI Protein Information
synaptotagmin-like protein 2
UniProt Protein Name
Synaptotagmin-like protein 2
UniProt Gene Name
SYTL2
UniProt Synonym Gene Names
KIAA1597; SGA72M; SLP2; SLP2A
UniProt Entry Name
SYTL2_HUMAN

NCBI Description

The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]

Uniprot Description

SYTL2: Isoform 1 acts as a RAB27A effector protein and plays a role in cytotoxic granule exocytosis in lymphocytes. It is required for cytotoxic granule docking at the immunologic synapse. Isoform 4 binds phosphatidylserine (PS) and phosphatidylinositol- 4,5-bisphosphate (PIP2) and promotes the recruitment of glucagon- containing granules to the cell membrane in pancreatic alpha cells. Binding to PS is inhibited by Ca(2+) while binding to PIP2 is Ca(2+) insensitive. 12 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Motility/polarity/chemotaxis; GAPs, Rab; GAPs; Lipid-binding

Chromosomal Location of Human Ortholog: 11q14

Cellular Component: cytoplasm; extrinsic to plasma membrane; melanosome; membrane; plasma membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; neurexin binding; phosphatase binding; phosphatidylinositol-4,5-bisphosphate binding; phosphatidylserine binding; protein binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; exocytosis; regulation of calcium ion-dependent exocytosis; vesicle docking during exocytosis; vesicle fusion; vesicle-mediated transport

Research Articles on SYTL2

Similar Products

Product Notes

The SYTL2 sytl2 (Catalog #AAA1265776) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaagt ctgttccagc atttctccaa gatgagagtg atgacagaga aacagataca gcatcagaaa gcagttacca gctcagcaga cacaagaaga gcccgagctc tttaaccaat cttagcagct cctctggcat gacgtccttg tcttctgtga gtggcagtgt gatgagtgtt tatagtggag actttggcaa tctggaagtt aaaggaaata ttcagtttgc aattgaatat gtggagtcac tgaaggagtt gcatgttttt gtggcccagt gtaaggactt agcagcagcg gatgtaaaaa aacagcgttc agacccatat gtaaaggcct atttgctacc agacaaaggc aaaatgggca agaagaaaac actcgtagtg aagaaaacct tgaatcctgt gtataacgaa atactgcggt ataaaattga aaaacaaatc ttaaagacac agaaattgaa cctgtccatt tggcatcggg atacatttaa gcgcaatagt ttcctagggg aggtggaact tgatttggaa acatgggact gggataacaa acagaataaa caattgagat ggtaccctct gaagcggaag acagcaccag ttgcccttga agcagaaaac agaggtgaaa tgaaactagc tctccagtat gtcccagagc cagtccctgg taaaaagctt cctacaactg gagaagtgca catctgggtg aaggaatgcc ttgatctacc actgctaagg ggaagtcatc taaattcttt tgttaaatgt accatccttc cagatacaag taggaaaagt cgccagaaga caagagctgt agggaaaacc accaacccta tcttcaacca cactatggtg tatgatgggt tcaggcctga agatctgatg gaagcctgtg tagagcttac tgtctgggac cattacaaat taaccaacca atttttggga ggtcttcgta ttggctttgg aacaggtaaa agttatggga ctgaagtgga ctggatggac tctacttcag aggaagttgc tctctgggag aagatggtaa actcccccaa tacttggatt gaagcaacac tgcctctcag aatgcttttg attgccaaga tttccaaatg a. It is sometimes possible for the material contained within the vial of "SYTL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.