SYTL1 cdna clone
SYTL1 cDNA Clone
Gene Names
SYTL1; JFC1; SLP1
Synonyms
SYTL1; SYTL1 cDNA Clone; SYTL1 cdna clone
Sequence
atgccccagaggggccacccatcgcaagaggggctttgggctctgccctccctccccatggcgcatgggccaaagcctgagactgaaggactgttggacctcagcttcctgacagaggaggagcaggaggccattgctggcgtcctccaacgagatgcccgcctgcgccagctggaggaggggcgggtcagcaagctccgggcctcagtggcagaccctgggcagctgaagatcctgacaggggactggttccaggaagcacgctcccagcggcaccacaatgcccacttcggctctgaccttgtccgagcgtctatgcgcaggaagaagagcaccaggggagaccaggctccaggccacgacagggaggctgaggctgctgtgaaagagaaggaagaggggccagagcccaggctcaccattgatgaggcccctcaggagaggctcagggagactgagggacctgatttcccatcgccttctgtccccctaaaggcttcagatcctgaggaggcgtcccaggcccaggaagatcctggccaaggagaccaacaggtctgtgccgaggaggctgacccggagctggagcccgcgtcggggggagagcaggagccgcggccccagcaagcccagaccaaggccgcgtcccagatcctggagaatggggaggaggccccggggcccgacccctctctcgaccgcatgctcagcagcagctcctcggtgtccagccttaactcctccacgctgagcggcagccagatgagcctgtcaggcgacgcggaggcggtgcaggtccgcggctccgtgcacttcgcgctgcactacgagccgggcgccgccgagctgcgcgtgcacgtgatccagtgccagggcctggccgccgcccggcgccgccgctcggacccctacgtcaaaagctacctcctcccggataagcagagcaagcgcaagacggcggtgaagaaacggaatctgaatccggttttcaacgagactctccggtactccgtcccgcaggccgagcttcagggccgcgtgctgagcctgtctgtgtggcaccgcgaaagcctgggtcgcaacatctttctgggcgaagttgaagtgcccctggacacgtgggactggggctctgagcccacctggctccccctgcagccccgggtcccaccctctcccgacgaccttccgagccgcgggttactcgccctgtccctcaagtacgtccccgccggctccgagggcgcaggactgcccccgagcggggagctgcacttctgggtgaaggaggctcgggacctcctgccgctgcgggcaggatccctggacacttacgtacaatgcttcgtgctgcctgatgacagccaggccagccgccagcgtacaagggttgtgcgacgcagcctcagccctgtgttcaatcacaccatggtgtacgatggctttgggcctgctgacctgcgccaggcttgtgccgagctctccctctgggaccatggggccctggccaaccgccagctggggggcacacgcctcagcctgggcaccggcagcagctatgggctgcaggtgccctggatggattccacacctgaggagaagcagctgtggcaagccctcctggagcagccgtgcgaatgggtggatggccttctacccctcagaaccaacctggcccccaggacgtag
Sequence Length
1689
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,635 Da
NCBI Official Full Name
Homo sapiens synaptotagmin-like 1, mRNA
NCBI Official Synonym Full Names
synaptotagmin like 1
NCBI Official Symbol
SYTL1
NCBI Official Synonym Symbols
JFC1; SLP1
NCBI Protein Information
synaptotagmin-like protein 1
UniProt Protein Name
Synaptotagmin-like protein 1
Protein Family
UniProt Gene Name
SYTL1
UniProt Synonym Gene Names
SLP1
UniProt Entry Name
SYTL1_HUMAN
Uniprot Description
SYTL1: May play a role in vesicle trafficking. Binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1p36.11
Cellular Component: extrinsic to plasma membrane; melanosome; plasma membrane
Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; neurexin binding; protein binding; syntaxin binding
Biological Process: calcium ion-dependent exocytosis of neurotransmitter; exocytosis; regulation of calcium ion-dependent exocytosis; vesicle fusion
Research Articles on SYTL1
Similar Products
Product Notes
The SYTL1 sytl1 (Catalog #AAA1266745) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccaga ggggccaccc atcgcaagag gggctttggg ctctgccctc cctccccatg gcgcatgggc caaagcctga gactgaagga ctgttggacc tcagcttcct gacagaggag gagcaggagg ccattgctgg cgtcctccaa cgagatgccc gcctgcgcca gctggaggag gggcgggtca gcaagctccg ggcctcagtg gcagaccctg ggcagctgaa gatcctgaca ggggactggt tccaggaagc acgctcccag cggcaccaca atgcccactt cggctctgac cttgtccgag cgtctatgcg caggaagaag agcaccaggg gagaccaggc tccaggccac gacagggagg ctgaggctgc tgtgaaagag aaggaagagg ggccagagcc caggctcacc attgatgagg cccctcagga gaggctcagg gagactgagg gacctgattt cccatcgcct tctgtccccc taaaggcttc agatcctgag gaggcgtccc aggcccagga agatcctggc caaggagacc aacaggtctg tgccgaggag gctgacccgg agctggagcc cgcgtcgggg ggagagcagg agccgcggcc ccagcaagcc cagaccaagg ccgcgtccca gatcctggag aatggggagg aggccccggg gcccgacccc tctctcgacc gcatgctcag cagcagctcc tcggtgtcca gccttaactc ctccacgctg agcggcagcc agatgagcct gtcaggcgac gcggaggcgg tgcaggtccg cggctccgtg cacttcgcgc tgcactacga gccgggcgcc gccgagctgc gcgtgcacgt gatccagtgc cagggcctgg ccgccgcccg gcgccgccgc tcggacccct acgtcaaaag ctacctcctc ccggataagc agagcaagcg caagacggcg gtgaagaaac ggaatctgaa tccggttttc aacgagactc tccggtactc cgtcccgcag gccgagcttc agggccgcgt gctgagcctg tctgtgtggc accgcgaaag cctgggtcgc aacatctttc tgggcgaagt tgaagtgccc ctggacacgt gggactgggg ctctgagccc acctggctcc ccctgcagcc ccgggtccca ccctctcccg acgaccttcc gagccgcggg ttactcgccc tgtccctcaa gtacgtcccc gccggctccg agggcgcagg actgcccccg agcggggagc tgcacttctg ggtgaaggag gctcgggacc tcctgccgct gcgggcagga tccctggaca cttacgtaca atgcttcgtg ctgcctgatg acagccaggc cagccgccag cgtacaaggg ttgtgcgacg cagcctcagc cctgtgttca atcacaccat ggtgtacgat ggctttgggc ctgctgacct gcgccaggct tgtgccgagc tctccctctg ggaccatggg gccctggcca accgccagct ggggggcaca cgcctcagcc tgggcaccgg cagcagctat gggctgcagg tgccctggat ggattccaca cctgaggaga agcagctgtg gcaagccctc ctggagcagc cgtgcgaatg ggtggatggc cttctacccc tcagaaccaa cctggccccc aggacgtag. It is sometimes possible for the material contained within the vial of "SYTL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
