Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT5 cdna clone

SYT5 cDNA Clone

Synonyms
SYT5; SYT5 cDNA Clone; SYT5 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcccggagcccccaaccccggggcctccatcgcccgacacgcctcccgactccagtcgcatcagccacggcccagtgcccccctgggccctggccaccatcgtgctggtctcaggcctcctcatcttcagctgctgtttctgtctctaccggaagagctgtcggaggcggacaggcaagaagagccaggcccaagcccaggtccaccttcaggaagtgaaggggctgggccagagttacatagacaaggtgcagccagaagtagaggagctggagccagcaccatccgggccagggcagcaggtggcagacaagcatgagctaggacaactgcagtactccctggattatgacttccagagtggccagctgctggtgggcattctgcaagcaatgggattggcagccttggatcttggtggctcctcggacccctatgtgcgggtctacctgctgccggacaaacggaggcggtacgagaccaaggtgcatcggcagacgctgaaccctcactttggggagaccttcgccttcaaggtcccctacgtggagctggggggcagggtgctggtcatggcggtgtacgacttcgaccgcttctctcgcaatgacgccatcggggaggtgcgggtccctatgagctccgtggacctggggcggccagtgcaggcctggcgggagctgcaggcggctccgcgggaggagcaggagaagcttggggacatctgcttctccctccgctatgtccccacggccgggaagctcaccgtcatcgtcctggaggctaaaaacctgaagaagatggacgtaggaggactgtcagatccatacgtcaaggtccacctgctgcagggcggcaaaaaggtgcggaagaagaaaaccaccatcaagaagaacactctgaacccctattacaacgaagctttcagcttcgaggtgccctgtgaccaagtccagaaggtgcaggtggagctgaccgtgctggactacgacaagctgggcaagaacgaggccatcgggagggtggccgtgggggcggccgccggcggggctggcctgcggcactgggcggacatgctggccaacccgcggcggcccattgcccagtggcactcgctgcggcccccggaccgagtgaggctgctgcctgcgccctga
Sequence Length
1161
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,474 Da
NCBI Official Full Name
Homo sapiens synaptotagmin V, mRNA
NCBI Official Synonym Full Names
synaptotagmin 5
NCBI Official Symbol
SYT5
NCBI Protein Information
synaptotagmin-5
UniProt Protein Name
Synaptotagmin-5
Protein Family
UniProt Gene Name
SYT5
UniProt Synonym Gene Names
SytV
UniProt Entry Name
SYT5_HUMAN

NCBI Description

Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators of vesicle fusion, allowing fusion in the presence of calcium, and as calcium receptors or sensor molecules (summary by Hudson and Birnbaum, 1995 [PubMed 7597049]).[supplied by OMIM, Feb 2011]

Uniprot Description

SYT5: May be involved in Ca(2+)-dependent exocytosis of secretory vesicles through Ca(2+) and phospholipid binding to the C2 domain or may serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Regulates the Ca(2+)- dependent secretion of norepinephrine in PC12 cells. Required for export from the endocytic recycling compartment to the cell surface. Belongs to the synaptotagmin family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.42|11p

Cellular Component: plasma membrane; synaptic vesicle membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; synaptic transmission; synaptic vesicle endocytosis; vesicle fusion

Research Articles on SYT5

Similar Products

Product Notes

The SYT5 syt5 (Catalog #AAA1272479) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcccgg agcccccaac cccggggcct ccatcgcccg acacgcctcc cgactccagt cgcatcagcc acggcccagt gcccccctgg gccctggcca ccatcgtgct ggtctcaggc ctcctcatct tcagctgctg tttctgtctc taccggaaga gctgtcggag gcggacaggc aagaagagcc aggcccaagc ccaggtccac cttcaggaag tgaaggggct gggccagagt tacatagaca aggtgcagcc agaagtagag gagctggagc cagcaccatc cgggccaggg cagcaggtgg cagacaagca tgagctagga caactgcagt actccctgga ttatgacttc cagagtggcc agctgctggt gggcattctg caagcaatgg gattggcagc cttggatctt ggtggctcct cggaccccta tgtgcgggtc tacctgctgc cggacaaacg gaggcggtac gagaccaagg tgcatcggca gacgctgaac cctcactttg gggagacctt cgccttcaag gtcccctacg tggagctggg gggcagggtg ctggtcatgg cggtgtacga cttcgaccgc ttctctcgca atgacgccat cggggaggtg cgggtcccta tgagctccgt ggacctgggg cggccagtgc aggcctggcg ggagctgcag gcggctccgc gggaggagca ggagaagctt ggggacatct gcttctccct ccgctatgtc cccacggccg ggaagctcac cgtcatcgtc ctggaggcta aaaacctgaa gaagatggac gtaggaggac tgtcagatcc atacgtcaag gtccacctgc tgcagggcgg caaaaaggtg cggaagaaga aaaccaccat caagaagaac actctgaacc cctattacaa cgaagctttc agcttcgagg tgccctgtga ccaagtccag aaggtgcagg tggagctgac cgtgctggac tacgacaagc tgggcaagaa cgaggccatc gggagggtgg ccgtgggggc ggccgccggc ggggctggcc tgcggcactg ggcggacatg ctggccaacc cgcggcggcc cattgcccag tggcactcgc tgcggccccc ggaccgagtg aggctgctgc ctgcgccctg a. It is sometimes possible for the material contained within the vial of "SYT5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.