Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT11 cdna clone

SYT11 cDNA Clone

Gene Names
SYT11; SYT12; sytXI
Synonyms
SYT11; SYT11 cDNA Clone; SYT11 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagatcaccaatatccgacctagctttgatgtgtcaccggtggtggccggcctcatcggggcctctgtgctggtggtgtgtgtctcggtgaccgtctttgtctggtcatgctgccaccagcaggcagagaagaagcacaagaacccaccatacaagtttattcacatgctcaaaggcatcagcatatacccagagaccctcagcaacaagaagaaaatcatcaaagtgcggagagacaaagatggtcctgggagggaaggtggacgtaggaacctgttggtggacgcagcagaggctggcctgctaagccgagacaaagatcccagggggcctagctctggatcttgtatagaccaattacccatcaaaatggactatggggaagaactaaggagccctattacaagcctgacccctggggagagcaaaaccacctctccatcatctccagaggaggatgtcatgctaggatccctcaccttctcagtggactataacttcccgaaaaaagccctggtggtgacaatccaggaggcccacgggctgccagtgatggatgaccagacccagggatctgacccctacatcaaaatgaccatccttcctgacaaacggcatcgggtgaagaccagagtgctgcggaagaccctggaccctgtgtttgacgagaccttcaccttctatggcatcccctacagccagctgcaggacctggtgctgcacttccttgtcctcagctttgaccgcttctctcgggatgatgtcattggcgaggtcatggtgccactggcaggggtggaccccagcacaggcaaggtacaactgaccagggacatcatcaaaaggaatatccagaagtgcatcagcagaggggagctccaggtgtctctgtcatatcagcctgtggcacagagaatgacagtggtggtcctcaaagccagacacttgccgaagatggatatcaccggtctctcaggtaatccttatgtcaaggtgaacgtctactacggcagaaagcgcattgccaagaagaaaacccatgtgaagaagtgcactttgaaccccatcttcaatgaatctttcatctacgacatccccactgacctcctgcctgatatcagcatcgagttcctcgttatcgacttcgatcgcaccaccaagaatgaggtggtggggaggctgatcctgggggcacacagtgtcacagccagtggtgctgaacactggagagaggtctgcgagagcccccgcaagcctgtggccaagtggcacagtctgagcgagtactaa
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,297 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XI, mRNA
NCBI Official Synonym Full Names
synaptotagmin 11
NCBI Official Symbol
SYT11
NCBI Official Synonym Symbols
SYT12; sytXI
NCBI Protein Information
synaptotagmin-11
UniProt Protein Name
Synaptotagmin-11
Protein Family
UniProt Gene Name
SYT11
UniProt Synonym Gene Names
KIAA0080; SytXI
UniProt Entry Name
SYT11_HUMAN

NCBI Description

This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that are known calcium sensors and mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. The encoded protein is also a substrate for ubiquitin-E3-ligase parkin. The gene has previously been referred to as synaptotagmin XII but has been renamed synaptotagmin XI to be consistent with mouse and rat official nomenclature. [provided by RefSeq, Apr 2010]

Uniprot Description

SYT11: May be involved in Ca(2+)-dependent exocytosis of secretory vesicles through Ca(2+) and phospholipid binding to the C2 domain or may serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Belongs to the synaptotagmin family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q21.2

Cellular Component: axon; dendritic spine; excitatory synapse; phagocytic vesicle; plasma membrane; postsynaptic density; presynaptic active zone membrane; synaptic vesicle

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; protein binding; protein homodimerization activity; syntaxin binding; ubiquitin protein ligase binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; negative regulation of neurotransmitter secretion; plasma membrane repair; protein homotetramerization; regulation of calcium ion-dependent exocytosis; vesicle fusion

Research Articles on SYT11

Similar Products

Product Notes

The SYT11 syt11 (Catalog #AAA1266682) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaga tcaccaatat ccgacctagc tttgatgtgt caccggtggt ggccggcctc atcggggcct ctgtgctggt ggtgtgtgtc tcggtgaccg tctttgtctg gtcatgctgc caccagcagg cagagaagaa gcacaagaac ccaccataca agtttattca catgctcaaa ggcatcagca tatacccaga gaccctcagc aacaagaaga aaatcatcaa agtgcggaga gacaaagatg gtcctgggag ggaaggtgga cgtaggaacc tgttggtgga cgcagcagag gctggcctgc taagccgaga caaagatccc agggggccta gctctggatc ttgtatagac caattaccca tcaaaatgga ctatggggaa gaactaagga gccctattac aagcctgacc cctggggaga gcaaaaccac ctctccatca tctccagagg aggatgtcat gctaggatcc ctcaccttct cagtggacta taacttcccg aaaaaagccc tggtggtgac aatccaggag gcccacgggc tgccagtgat ggatgaccag acccagggat ctgaccccta catcaaaatg accatccttc ctgacaaacg gcatcgggtg aagaccagag tgctgcggaa gaccctggac cctgtgtttg acgagacctt caccttctat ggcatcccct acagccagct gcaggacctg gtgctgcact tccttgtcct cagctttgac cgcttctctc gggatgatgt cattggcgag gtcatggtgc cactggcagg ggtggacccc agcacaggca aggtacaact gaccagggac atcatcaaaa ggaatatcca gaagtgcatc agcagagggg agctccaggt gtctctgtca tatcagcctg tggcacagag aatgacagtg gtggtcctca aagccagaca cttgccgaag atggatatca ccggtctctc aggtaatcct tatgtcaagg tgaacgtcta ctacggcaga aagcgcattg ccaagaagaa aacccatgtg aagaagtgca ctttgaaccc catcttcaat gaatctttca tctacgacat ccccactgac ctcctgcctg atatcagcat cgagttcctc gttatcgact tcgatcgcac caccaagaat gaggtggtgg ggaggctgat cctgggggca cacagtgtca cagccagtgg tgctgaacac tggagagagg tctgcgagag cccccgcaag cctgtggcca agtggcacag tctgagcgag tactaa. It is sometimes possible for the material contained within the vial of "SYT11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.