Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYS1 cdna clone

SYS1 cDNA Clone

Gene Names
SYS1; C20orf169; dJ453C12.4; dJ453C12.4.1
Synonyms
SYS1; SYS1 cDNA Clone; SYS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggtcagttccgcagctacgtgtgggacccgctgctgatcctgtcgcagatcgtcctcatgcagaccgtgtattacggctcgctgggcctgtggctggcgctggtggacgggctagtgcgaagcagcccctcgctggaccagatgttcgacgccgagatcctgggcttttccacccctccaggccggctctccatgatgtccttcatcctcaacgccctcacctgtgccctgggcttgctgtacttcatccggcgaggaaagcagtgtctggatttcactgtcactgtccatttctttcacctcctgggctgctggttctacagctcccgtttcccctcggcgctgacctggtggctggtccaagccgtgtgcattgcactcatggctgtcatcggggagtacctgtgcatgcggacggagctcaaggagatacccctcaactcagcccctaaatccaatgtctag
Sequence Length
471
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,444 Da
NCBI Official Full Name
Homo sapiens SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SYS1, golgi trafficking protein
NCBI Official Symbol
SYS1
NCBI Official Synonym Symbols
C20orf169; dJ453C12.4; dJ453C12.4.1
NCBI Protein Information
protein SYS1 homolog
UniProt Protein Name
Protein SYS1 homolog
Protein Family
UniProt Gene Name
SYS1
UniProt Synonym Gene Names
C20orf169
UniProt Entry Name
SYS1_HUMAN

NCBI Description

SYS1 forms a complex with ADP-ribosylation factor-related protein ARFRP1 (MIM 604699) and targets ARFRP1 to the Golgi apparatus (Behnia et al., 2004 [PubMed 15077113]).[supplied by OMIM, Aug 2009]

Uniprot Description

SYS1: Involved in protein trafficking. May serve as a receptor for ARFRP1. Belongs to the SYS1 family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: integral to Golgi membrane; trans-Golgi network; trans-Golgi network membrane

Biological Process: Golgi to endosome transport; Golgi to plasma membrane protein transport; protein targeting to Golgi

Similar Products

Product Notes

The SYS1 sys1 (Catalog #AAA1277251) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggtc agttccgcag ctacgtgtgg gacccgctgc tgatcctgtc gcagatcgtc ctcatgcaga ccgtgtatta cggctcgctg ggcctgtggc tggcgctggt ggacgggcta gtgcgaagca gcccctcgct ggaccagatg ttcgacgccg agatcctggg cttttccacc cctccaggcc ggctctccat gatgtccttc atcctcaacg ccctcacctg tgccctgggc ttgctgtact tcatccggcg aggaaagcag tgtctggatt tcactgtcac tgtccatttc tttcacctcc tgggctgctg gttctacagc tcccgtttcc cctcggcgct gacctggtgg ctggtccaag ccgtgtgcat tgcactcatg gctgtcatcg gggagtacct gtgcatgcgg acggagctca aggagatacc cctcaactca gcccctaaat ccaatgtcta g. It is sometimes possible for the material contained within the vial of "SYS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.