Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYK cdna clone

SYK cDNA Clone

Gene Names
SYK; p72-Syk
Synonyms
SYK; SYK cDNA Clone; SYK cdna clone
Ordering
For Research Use Only!
Sequence
atggccagcagcggcatggctgacagcgccaaccacctgcccttctttttcggcaacatcacccgggaggaggcagaagattacctggtccaggggggcatgagtgatgggctttatttgctgcgccagagccgcaactacctgggtggcttcgccctgtccgtggcccacgggaggaaggcacaccactacaccatcgagcgggagctgaatggcacctacgccatcgccggtggcaggacccatgccagccccgccgacctctgccactaccactcccaggagtctgatggcctggtctgcctcctcaagaagcccttcaaccggccccaaggggtgcagcccaagactgggccctttgaggatttgaaggaaaacctcatcagggaatatgtgaagcagacatggaacctgcagggtcaggctctggagcaggccatcatcagtcagaagcctcagctggagaagctgatcgctaccacagcccatgaaaaaatgccttggttccatggaaaaatctctcgggaagaatctgagcaaattgtcctgataggatcaaagacaaatggaaagttcctgatccgagccagagacaacaacggctcctacgccctgtgcctgctgcacgaagggaaggtgctgcactatcgcatcgacaaagacaagacagggaagctctccatccccgagggaaagaagttcgacacgctctggcagctagtcgagcattattcttataaagcagatggtttgttaagagttcttactgtcccatgtcaaaaaatcggcacacagggaaatgttaattttggaggccgtccacaacttccaggttcccatcctgcgacttggtcagcgggtggaataatctcaagaatcaaatcatactccttcccaaagcctggccacagaaagtcctcccctgcccaagggaaccggcaagagagtactgtgtcattcaatccgtatgagccagaacttgcaccctgggctgcagacaaaggcccccagagagaagccctacccatggacacagaggtgtacgagagcccctacgcggaccctgaggagatcaggcccaaggaggtttacctggaccgaaagctgctgacgctggaagacaaagaactgggctctggtaattttggaactgtgaaaaagggctactaccaaatgaaaaaagttgtgaaaaccgtggctgtgaaaatactgaaaaacgaggccaatgaccccgctcttaaagatgagttattagcagaagcaaatgtcatgcagcagctggacaacccgtacatcgtgcgcatgatcgggatatgcgaggccgagtcctggatgctagttatggagatggcagaacttggtcccctcaataagtatttgcagcagaacagacatgtcaaggataagaacatcatagaactggttcatcaggtttccatgggcatgaagtacttggaggagagcaattttgtgcacagagatctggctgcaagaaatgtgttgctagttacccaacattatgccaagatcagtgatttcggactctccaaagcactgcgtgctgatgaaaactactacaaggcccagacccatggaaagtggcctgtcaagtggtacgctccggaatgcatcaactactacaagttctccagcaaaagcgatgtctggagctttggagtgttgatgtgggaagcattctcctatgggcagaagccatatcgagggatgaaaggaagtgaagtcaccgctatgttagagaaaggagagcggatggggtgccctgcagggtgtccaagagagatgtacgatctcatgaatctgtgctggacatacgatgtggaaaacaggcccggattcgcagcagtggaactgcggctgcgcaattactactatgacgtggtgaactaa
Sequence Length
1908
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,510 Da
NCBI Official Full Name
Homo sapiens spleen tyrosine kinase, mRNA
NCBI Official Synonym Full Names
spleen associated tyrosine kinase
NCBI Official Symbol
SYK
NCBI Official Synonym Symbols
p72-Syk
NCBI Protein Information
tyrosine-protein kinase SYK
UniProt Protein Name
Tyrosine-protein kinase SYK
Protein Family
UniProt Gene Name
SYK
UniProt Entry Name
KSYK_HUMAN

NCBI Description

This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

Uniprot Description

Syk: a cytoplasmic tyrosine kinase of the SYK family containing two SH2 domains. Plays a central role in the B cell receptor (BCR) response. An upstream activator of the PI3K, PLCgamma2, and Rac/cdc42 pathways in the BCR response. Required for the sequential events of Fc gamma IIa receptor-mediated phagocytosis. Expression highest in murine spleen, heart, mammary gland and thymus. Two splice variant isoforms have been described.

Protein type: EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); Protein kinase, TK; Kinase, protein; TK group; Syk family

Chromosomal Location of Human Ortholog: 9q22

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; nucleus; plasma membrane; protein complex; T cell receptor complex

Molecular Function: integrin binding; non-membrane spanning protein tyrosine kinase activity; protein binding; protein kinase activity; protein serine/threonine kinase activity; protein-tyrosine kinase activity

Biological Process: adaptive immune response; B cell receptor signaling pathway; blood vessel morphogenesis; cell proliferation; defense response to bacterium; inflammatory response; innate immune response; integrin-mediated signaling pathway; leukocyte activation during immune response; leukocyte adhesion; lymph vessel development; macrophage activation during immune response; neutrophil activation during immune response; neutrophil chemotaxis; organ morphogenesis; platelet activation; positive regulation of alpha-beta T cell proliferation; positive regulation of B cell differentiation; positive regulation of bone resorption; positive regulation of cell adhesion mediated by integrin; positive regulation of mast cell degranulation; protein amino acid phosphorylation; receptor internalization; regulation of neutrophil degranulation; regulation of phagocytosis; regulation of superoxide release; regulation of transcription factor activity; serotonin secretion by platelet; stimulatory C-type lectin receptor signaling pathway; transcription factor import into nucleus; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on SYK

Similar Products

Product Notes

The SYK syk (Catalog #AAA1273382) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagca gcggcatggc tgacagcgcc aaccacctgc ccttcttttt cggcaacatc acccgggagg aggcagaaga ttacctggtc caggggggca tgagtgatgg gctttatttg ctgcgccaga gccgcaacta cctgggtggc ttcgccctgt ccgtggccca cgggaggaag gcacaccact acaccatcga gcgggagctg aatggcacct acgccatcgc cggtggcagg acccatgcca gccccgccga cctctgccac taccactccc aggagtctga tggcctggtc tgcctcctca agaagccctt caaccggccc caaggggtgc agcccaagac tgggcccttt gaggatttga aggaaaacct catcagggaa tatgtgaagc agacatggaa cctgcagggt caggctctgg agcaggccat catcagtcag aagcctcagc tggagaagct gatcgctacc acagcccatg aaaaaatgcc ttggttccat ggaaaaatct ctcgggaaga atctgagcaa attgtcctga taggatcaaa gacaaatgga aagttcctga tccgagccag agacaacaac ggctcctacg ccctgtgcct gctgcacgaa gggaaggtgc tgcactatcg catcgacaaa gacaagacag ggaagctctc catccccgag ggaaagaagt tcgacacgct ctggcagcta gtcgagcatt attcttataa agcagatggt ttgttaagag ttcttactgt cccatgtcaa aaaatcggca cacagggaaa tgttaatttt ggaggccgtc cacaacttcc aggttcccat cctgcgactt ggtcagcggg tggaataatc tcaagaatca aatcatactc cttcccaaag cctggccaca gaaagtcctc ccctgcccaa gggaaccggc aagagagtac tgtgtcattc aatccgtatg agccagaact tgcaccctgg gctgcagaca aaggccccca gagagaagcc ctacccatgg acacagaggt gtacgagagc ccctacgcgg accctgagga gatcaggccc aaggaggttt acctggaccg aaagctgctg acgctggaag acaaagaact gggctctggt aattttggaa ctgtgaaaaa gggctactac caaatgaaaa aagttgtgaa aaccgtggct gtgaaaatac tgaaaaacga ggccaatgac cccgctctta aagatgagtt attagcagaa gcaaatgtca tgcagcagct ggacaacccg tacatcgtgc gcatgatcgg gatatgcgag gccgagtcct ggatgctagt tatggagatg gcagaacttg gtcccctcaa taagtatttg cagcagaaca gacatgtcaa ggataagaac atcatagaac tggttcatca ggtttccatg ggcatgaagt acttggagga gagcaatttt gtgcacagag atctggctgc aagaaatgtg ttgctagtta cccaacatta tgccaagatc agtgatttcg gactctccaa agcactgcgt gctgatgaaa actactacaa ggcccagacc catggaaagt ggcctgtcaa gtggtacgct ccggaatgca tcaactacta caagttctcc agcaaaagcg atgtctggag ctttggagtg ttgatgtggg aagcattctc ctatgggcag aagccatatc gagggatgaa aggaagtgaa gtcaccgcta tgttagagaa aggagagcgg atggggtgcc ctgcagggtg tccaagagag atgtacgatc tcatgaatct gtgctggaca tacgatgtgg aaaacaggcc cggattcgca gcagtggaac tgcggctgcg caattactac tatgacgtgg tgaactaa. It is sometimes possible for the material contained within the vial of "SYK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.