SYF2 cdna clone
SYF2 cDNA Clone
Gene Names
SYF2; P29; CBPIN; NTC31; fSAP29
Synonyms
SYF2; SYF2 cDNA Clone; SYF2 cdna clone
Sequence
atggcggctatagctgcatccgaggtgctggtggacagcgcggaggaggggtccctcgctgcggcggcggagctggccgctcagaagcgcgaacagagactgcgcaaattccgggagctgcacctgatgcggaatgaagctcgtaaattaaatcaccaggaagttgtggaagaagataaaagactaaaattacctgcaaattgggaagccaaaaaagctcgtttggagtgggaactaaaggaagaggaaaagaaaaaggaatgtgcggcaagaggagaagactatgagaaagtgaagttgctggagatcagtgcagaagatgcagaaagatgggagaggaaaaagaagaggaaaaaccctgatctgggattttcagattatgctgctgcccagttacgccagtatcatcggttgaccaagcagatcaaacctgacatggaaacatatgagagactgagagaaaaacatggagaagagtttttcccaacatccaatagtcttcttcatggaacacatgtgccttccacagaggaaattgacaggatggtcatagatctggaaaaacagattgaaaaacgagacaaatatagccggagacgtccttataatgatgatgcagatatcgactacattaatgaaaggaatgccaaattcaacaagaaagctgaaagattctatgggaaatacacagctgaaattaaacagaatttggaaagaggaacagctgtctaa
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,569 Da
NCBI Official Full Name
Homo sapiens SYF2 homolog, RNA splicing factor (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SYF2 pre-mRNA splicing factor
NCBI Official Symbol
SYF2
NCBI Official Synonym Symbols
P29; CBPIN; NTC31; fSAP29
NCBI Protein Information
pre-mRNA-splicing factor SYF2
UniProt Protein Name
Pre-mRNA-splicing factor SYF2
Protein Family
UniProt Gene Name
SYF2
UniProt Synonym Gene Names
CBPIN; GCIPIP
UniProt Entry Name
SYF2_HUMAN
NCBI Description
This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Uniprot Description
SYF2: May be involved in pre-mRNA splicing. Belongs to the SYF2 family.
Protein type: RNA-binding; Spliceosome; RNA splicing; RNA processing
Chromosomal Location of Human Ortholog: 1p36.11
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: nuclear mRNA splicing, via spliceosome
Research Articles on SYF2
Similar Products
Product Notes
The SYF2 syf2 (Catalog #AAA1274164) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcta tagctgcatc cgaggtgctg gtggacagcg cggaggaggg gtccctcgct gcggcggcgg agctggccgc tcagaagcgc gaacagagac tgcgcaaatt ccgggagctg cacctgatgc ggaatgaagc tcgtaaatta aatcaccagg aagttgtgga agaagataaa agactaaaat tacctgcaaa ttgggaagcc aaaaaagctc gtttggagtg ggaactaaag gaagaggaaa agaaaaagga atgtgcggca agaggagaag actatgagaa agtgaagttg ctggagatca gtgcagaaga tgcagaaaga tgggagagga aaaagaagag gaaaaaccct gatctgggat tttcagatta tgctgctgcc cagttacgcc agtatcatcg gttgaccaag cagatcaaac ctgacatgga aacatatgag agactgagag aaaaacatgg agaagagttt ttcccaacat ccaatagtct tcttcatgga acacatgtgc cttccacaga ggaaattgac aggatggtca tagatctgga aaaacagatt gaaaaacgag acaaatatag ccggagacgt ccttataatg atgatgcaga tatcgactac attaatgaaa ggaatgccaa attcaacaag aaagctgaaa gattctatgg gaaatacaca gctgaaatta aacagaattt ggaaagagga acagctgtct aa. It is sometimes possible for the material contained within the vial of "SYF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
