SUPT3H cdna clone
SUPT3H cDNA Clone
Gene Names
SUPT3H; SPT3; SPT3L
Synonyms
SUPT3H; SUPT3H cDNA Clone; SUPT3H cdna clone
Sequence
atggtggtctttggaacaacgttcttcaactttgacagcttcatagggaaaacagattctatagaaataattggaaaatcagtttttccctattgttatcacaatatccttccactgctgaatgattctggcaggtattctttaggtgatgctagaaggcctcttcatgaaacagcagttttggtagaagatgtggtacacactcagttaattaatctgttacagcaagctgctgaagtttctcagctgcggggagcaagggtaatcactcctgaagatcttctgtttttgatgcgcaaagataagaaaaaacttagaagactgctaaaatacatgtttatccgagactacaaatcaaagattgtcaaaggcatcgatgaggatgatcttctcgaagacaaattgagtggcagcaataatgcgaacaaaagacaaaagattgctcaggacttcctcaactctattgaccagacaggagaacttttagcaatgtttgaagatgacgaaattgatgaagttaaacaagaaagaatggagagagcagaaagacaaactcgaattatggattcagctcaatatgcagaattctgtgaaagtcgacaattaagtttctccaaaaaagcttccaaatttcgagactggttggactgcagcagtatggagataaaacccaatgttgtcgcaatggaaatcttagcatatttagcgtatgaaactgtggcacagttagtggatctggctcttcttgtgaggcaagacatggtaaccaaggcaggggaccccttcagccatgccatttctgcaaccttcattcagtatcacaactctgctgagagcactgcagcctgtggtgttgaggctcacagcgatgccatccagccctgccacatcagagaggccattcgacgctacagccacaggattggcccactttccccattcacaaatgcctaccgcaggaatgggatggcttttctagcctgctga
Sequence Length
987
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,427 Da
NCBI Official Full Name
Homo sapiens suppressor of Ty 3 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SPT3 homolog, SAGA and STAGA complex component
NCBI Official Symbol
SUPT3H
NCBI Official Synonym Symbols
SPT3; SPT3L
NCBI Protein Information
transcription initiation protein SPT3 homolog
UniProt Protein Name
Transcription initiation protein SPT3 homolog
Protein Family
UniProt Gene Name
SUPT3H
UniProt Synonym Gene Names
SPT3
UniProt Entry Name
SUPT3_HUMAN
Uniprot Description
SUPT3H: Probable transcriptional activator. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 6p21.1-p21.3
Cellular Component: nucleoplasm; nucleus; transcription factor TFIID complex
Molecular Function: DNA binding; histone acetyltransferase activity; transcription coactivator activity
Biological Process: histone deubiquitination; positive regulation of defense response to virus by host; regulation of transcription from RNA polymerase II promoter
Research Articles on SUPT3H
Similar Products
Product Notes
The SUPT3H supt3h (Catalog #AAA1276739) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggtct ttggaacaac gttcttcaac tttgacagct tcatagggaa aacagattct atagaaataa ttggaaaatc agtttttccc tattgttatc acaatatcct tccactgctg aatgattctg gcaggtattc tttaggtgat gctagaaggc ctcttcatga aacagcagtt ttggtagaag atgtggtaca cactcagtta attaatctgt tacagcaagc tgctgaagtt tctcagctgc ggggagcaag ggtaatcact cctgaagatc ttctgttttt gatgcgcaaa gataagaaaa aacttagaag actgctaaaa tacatgttta tccgagacta caaatcaaag attgtcaaag gcatcgatga ggatgatctt ctcgaagaca aattgagtgg cagcaataat gcgaacaaaa gacaaaagat tgctcaggac ttcctcaact ctattgacca gacaggagaa cttttagcaa tgtttgaaga tgacgaaatt gatgaagtta aacaagaaag aatggagaga gcagaaagac aaactcgaat tatggattca gctcaatatg cagaattctg tgaaagtcga caattaagtt tctccaaaaa agcttccaaa tttcgagact ggttggactg cagcagtatg gagataaaac ccaatgttgt cgcaatggaa atcttagcat atttagcgta tgaaactgtg gcacagttag tggatctggc tcttcttgtg aggcaagaca tggtaaccaa ggcaggggac cccttcagcc atgccatttc tgcaaccttc attcagtatc acaactctgc tgagagcact gcagcctgtg gtgttgaggc tcacagcgat gccatccagc cctgccacat cagagaggcc attcgacgct acagccacag gattggccca ctttccccat tcacaaatgc ctaccgcagg aatgggatgg cttttctagc ctgctga. It is sometimes possible for the material contained within the vial of "SUPT3H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
