Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

SUMO4 cdna clone

SUMO4 cDNA Clone

Gene Names
SUMO4; IDDM5; SMT3H4; SUMO-4; dJ281H8.4
Synonyms
SUMO4; SUMO4 cDNA Clone; SUMO4 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggccaacgaaaagcccacagaagaagtcaagactgagaacaacaatcatattaatttgaaggtggcgggacaggatggttctgtggtgcagtttaagattaagaggcagacaccacttagtaaactaatgaaagcctattgtgaaccacggggattgtcagtgaagcagatcagattccgatttggtgggcaaccaatcagtggaacagacaaacctgcacagttggaaatggaagatgaagatacaattgatgtgtttcaacagcctacgggaggtgtctactga
Sequence Length
288
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,685 Da
NCBI Official Full Name
Homo sapiens SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
small ubiquitin-like modifier 4
NCBI Official Symbol
SUMO4
NCBI Official Synonym Symbols
IDDM5; SMT3H4; SUMO-4; dJ281H8.4
NCBI Protein Information
small ubiquitin-related modifier 4
UniProt Protein Name
Small ubiquitin-related modifier 4
UniProt Gene Name
SUMO4
UniProt Synonym Gene Names
SMT3H4; SUMO-4
UniProt Entry Name
SUMO4_HUMAN

NCBI Description

This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism. [provided by RefSeq, Jul 2008]

Uniprot Description

SUMO4: Ubiquitin-like protein which can be covalently attached to target lysines as a monomer. Does not seem to be involved in protein degradation and may modulate protein subcellular localization, stability or activity. Upon oxidative stress, conjugates to various anti-oxidant enzymes, chaperones, and stress defense proteins. May also conjugate to NFKBIA, TFAP2A and FOS, negatively regulating their transcriptional activity, and to NR3C1, positively regulating its transcriptional activity. Covalent attachment to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I. Belongs to the ubiquitin family. SUMO subfamily.

Protein type: Ubiquitin-like modifier

Chromosomal Location of Human Ortholog: 6q25

Cellular Component: nucleus

Molecular Function: protein tag

Biological Process: protein sumoylation

Disease: Diabetes Mellitus, Insulin-dependent, 5

Research Articles on SUMO4

Similar Products

Product Notes

The SUMO4 sumo4 (Catalog #AAA1272782) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaacg aaaagcccac agaagaagtc aagactgaga acaacaatca tattaatttg aaggtggcgg gacaggatgg ttctgtggtg cagtttaaga ttaagaggca gacaccactt agtaaactaa tgaaagccta ttgtgaacca cggggattgt cagtgaagca gatcagattc cgatttggtg ggcaaccaat cagtggaaca gacaaacctg cacagttgga aatggaagat gaagatacaa ttgatgtgtt tcaacagcct acgggaggtg tctactga. It is sometimes possible for the material contained within the vial of "SUMO4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual