Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SUB1 cdna clone

SUB1 cDNA Clone

Gene Names
SUB1; P15; PC4; p14
Synonyms
SUB1; SUB1 cDNA Clone; SUB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctaaatcaaaggaacttgtttcttcaggctcttctggcagtgattctgacagtgaggttgacaaaaagttaaagaggaaaaagcaagttgctccagaaaaacctgtaaagaaacaaaagacaggtgagacttcgagagccctgtcatcttctaaacagagcagcagcagcagagatgataacatgtttcagattgggaaaatgaggtacgttagtgttcgcgattttaaaggcaaagtgctaattgatattagagaatattggatggatcctgaaggtgaaatgaaaccaggaagaaaaggtatttctttaaatccagaacaatggagccagctgaaggaacagatttctgacattgatgatgcagtaagaaaactgtaa
Sequence Length
384
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,395 Da
NCBI Official Full Name
Homo sapiens SUB1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SUB1 homolog, transcriptional regulator
NCBI Official Symbol
SUB1
NCBI Official Synonym Symbols
P15; PC4; p14
NCBI Protein Information
activated RNA polymerase II transcriptional coactivator p15
UniProt Protein Name
Activated RNA polymerase II transcriptional coactivator p15
Protein Family
UniProt Gene Name
SUB1
UniProt Synonym Gene Names
PC4; RPO2TC1; PC4
UniProt Entry Name
TCP4_HUMAN

Uniprot Description

PC4: a transcriptional coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. May be involved in stabilizing the multiprotein transcription complex. Binds single-stranded DNA. Also binds, in vitro, nonspecifically to double-stranded DNA (ds DNA). Interacts with CSTF2. Its activity is controlled by phosphorylation of the regulatory domain. Phosphorylation inactivates both dsDNA-binding and cofactor function. Seems to be phosphorylated in vivo by CK2 in at least 7 sites in the N-terminal Ser-rich region.

Protein type: Nuclear receptor co-regulator; DNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 5p13.3

Cellular Component: nucleolus; nucleus; transcription factor complex

Molecular Function: protein binding; single-stranded DNA binding; transcription coactivator activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Research Articles on SUB1

Similar Products

Product Notes

The SUB1 sub1 (Catalog #AAA1274588) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctaaat caaaggaact tgtttcttca ggctcttctg gcagtgattc tgacagtgag gttgacaaaa agttaaagag gaaaaagcaa gttgctccag aaaaacctgt aaagaaacaa aagacaggtg agacttcgag agccctgtca tcttctaaac agagcagcag cagcagagat gataacatgt ttcagattgg gaaaatgagg tacgttagtg ttcgcgattt taaaggcaaa gtgctaattg atattagaga atattggatg gatcctgaag gtgaaatgaa accaggaaga aaaggtattt ctttaaatcc agaacaatgg agccagctga aggaacagat ttctgacatt gatgatgcag taagaaaact gtaa. It is sometimes possible for the material contained within the vial of "SUB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.