STOML2 cdna clone
STOML2 cDNA Clone
Gene Names
STOML2; SLP-2; HSPC108
Synonyms
STOML2; STOML2 cDNA Clone; STOML2 cdna clone
Sequence
atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcctggagcctggtttgaacatcctcatccctgtgttagaccggatccgatatgtgcagagtctcaaggaaattgtcatcaacgtgcctgagcagtcggctgtgactctcgacaatgtaactctgcaaatcgatggagtcctttacctgcgcatcatggacccttacaaggcaagctacggtgtggaggaccctgagtatgccgtcacccagctagctcaaacaaccatgagatcagagctcggcaaactctctctggacaaagtcttccgggaacgggagtccctgaatgccagcattgtggatgccatcaaccaagctgctgactgctggggtatccgctgcctccgttatgagatcaaggatatccatgtgccaccccgggtgaaagagtctatgcagatgcaggtggaggcagagcggcggaaacgggccacagttctagagtctgaggggacccgagagtcggccatcaatgtggcagaagggaagaaacaggcccagatcctggcctccgaagcagaaaaggctgaacagataaatcaggcagcaggagaggccagtgcagttctggcgaaggccaaggctaaagctgaagctattcgaatcctggctgcagctctgacacaacataatggagatgcagcagcttcactgactgtggccgagcagtatgtcagcgcgttctccaaactggccaaggactccaacactatcctactgccctccaaccctggcgatgtcaccagcatggtggctcaggccatgggtgtatatggagccctcaccaaagccccagtgccagggactccagactcactctccagtgggagcagcagagatgtccagggtacagatgcaagtcttgatgaggaacttgatcgagtcaagatgagttag
Sequence Length
1071
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,337 Da
NCBI Official Full Name
Homo sapiens stomatin (EPB72)-like 2, mRNA
NCBI Official Synonym Full Names
stomatin like 2
NCBI Official Symbol
STOML2
NCBI Official Synonym Symbols
SLP-2; HSPC108
NCBI Protein Information
stomatin-like protein 2, mitochondrial
UniProt Protein Name
Stomatin-like protein 2, mitochondrial
Protein Family
UniProt Gene Name
STOML2
UniProt Synonym Gene Names
SLP2; SLP-2; Paratarg-7
UniProt Entry Name
STML2_HUMAN
Uniprot Description
SLP-2: Belongs to the band 7/mec-2 family.
Protein type: Mitochondrial; Cytoskeletal
Chromosomal Location of Human Ortholog: 9p13.1
Cellular Component: actin cytoskeleton; cytoskeleton; extrinsic to plasma membrane; immunological synapse; lipid raft; mitochondrial inner membrane; mitochondrial intermembrane space; signalosome; T cell receptor complex
Molecular Function: GTPase binding; protein binding; receptor binding
Biological Process: cellular calcium ion homeostasis; interleukin-2 production; mitochondrial ATP synthesis coupled proton transport; mitochondrial calcium ion transport; mitochondrion organization and biogenesis; protein oligomerization; T cell receptor signaling pathway
Research Articles on STOML2
Similar Products
Product Notes
The STOML2 stoml2 (Catalog #AAA1273336) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggcgc gcgcggcgcg gggcactggg gcccttttgc tgaggggctc tctactggct tctggccgcg ctccgcgccg cgcctcctct ggattgcccc gaaacaccgt ggtactgttc gtgccgcagc aggaggcctg ggtggtggag cgaatgggcc gattccaccg gatcctggag cctggtttga acatcctcat ccctgtgtta gaccggatcc gatatgtgca gagtctcaag gaaattgtca tcaacgtgcc tgagcagtcg gctgtgactc tcgacaatgt aactctgcaa atcgatggag tcctttacct gcgcatcatg gacccttaca aggcaagcta cggtgtggag gaccctgagt atgccgtcac ccagctagct caaacaacca tgagatcaga gctcggcaaa ctctctctgg acaaagtctt ccgggaacgg gagtccctga atgccagcat tgtggatgcc atcaaccaag ctgctgactg ctggggtatc cgctgcctcc gttatgagat caaggatatc catgtgccac cccgggtgaa agagtctatg cagatgcagg tggaggcaga gcggcggaaa cgggccacag ttctagagtc tgaggggacc cgagagtcgg ccatcaatgt ggcagaaggg aagaaacagg cccagatcct ggcctccgaa gcagaaaagg ctgaacagat aaatcaggca gcaggagagg ccagtgcagt tctggcgaag gccaaggcta aagctgaagc tattcgaatc ctggctgcag ctctgacaca acataatgga gatgcagcag cttcactgac tgtggccgag cagtatgtca gcgcgttctc caaactggcc aaggactcca acactatcct actgccctcc aaccctggcg atgtcaccag catggtggct caggccatgg gtgtatatgg agccctcacc aaagccccag tgccagggac tccagactca ctctccagtg ggagcagcag agatgtccag ggtacagatg caagtcttga tgaggaactt gatcgagtca agatgagtta g. It is sometimes possible for the material contained within the vial of "STOML2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
