Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAM cdna clone

STAM cDNA Clone

Gene Names
STAM; STAM1; STAM-1
Synonyms
STAM; STAM cDNA Clone; STAM cdna clone
Ordering
For Research Use Only!
Sequence
atgcctctttttgccaccaatcccttcgatcaggatgttgagaaagcaaccagcgagatgaatactgctgaggactggggcctcattttggatatctgtgataaagttggtcagtctcgcactggacctaaggattgtcttcggtctattatgagaagagtgaaccacaaagatcctcacgttgctatgcaggctttgactcttctaggagcatgtgtatcaaactgtggcaaaatttttcatttagaagtatgttcaagagattttgctagtgaagtaagcaacgtattaaataagggtcatcctaaagtatgtgaaaaattaaaggctcttatggttgaatggacagatgaatttaagaatgatccacagcttagtctaatatcagcaatgattaagaaccttaaggaacaaggagttacgttcccagctattggctctcaggctgcagaacaagcaaaagcaagcccagctcttgtagccaaggatcctggtactgtggctaacaaaaaagaagaagaagatttagcaaaagccattgagttgtctctcaaggaacaaaggcagcagtcaaccaccctttccactttgtatccaagcacatccagtctcttaactaaccaccaacatgaaggccgaaaagttcgtgctatatatgactttgaagctgctgaagacaatgaacttacttttaaagctggagaaattattacagttcttgatgacagtgatcctaactggtggaaaggtgaaacccatcaaggcatagggttatttccttctaattttgtgactgcatatctcactgctgaaccagaaatgattaaaacagagaagaagacggtacaatttagtgatgatgttcaggtagagacaatagaaccagagccggaaccagcctttattgatgaagataaaatggaccagttgctacagatgctgcaaagtacagaccccagtgatgatcagccagacctaccagagctgcttcatcttgaagcaatgtgtcaccagatgggacctctcattgatgaaaagctggaagatattgatagaaaacattcagaactctcagaacttaatgtgaaagtgatggaggccctttccttatataccaagttaatgaacgaagatccgatgtattccatgtatgcaaagttacagaatcagccaggcagtggtcccaccatccgcaaacccagcccttcctag
Sequence Length
1212
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,972 Da
NCBI Official Full Name
Homo sapiens signal transducing adaptor molecule (SH3 domain and ITAM motif) 1, mRNA
NCBI Official Synonym Full Names
signal transducing adaptor molecule
NCBI Official Symbol
STAM
NCBI Official Synonym Symbols
STAM1; STAM-1
NCBI Protein Information
signal transducing adapter molecule 1
UniProt Protein Name
Signal transducing adapter molecule 1
Protein Family
UniProt Gene Name
STAM
UniProt Synonym Gene Names
STAM1; STAM-1
UniProt Entry Name
STAM1_HUMAN

NCBI Description

This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

STAM1: Involved in intracellular signal transduction mediated by cytokines and growth factors. Upon IL-2 and GM-CSL stimulation, it plays a role in signaling leading to DNA synthesis and MYC induction. May also play a role in T-cell development. Involved in down-regulation of receptor tyrosine kinase via multivesicular body (MVBs) when complexed with HGS (ESCRT-0 complex). The ESCRT-0 complex binds ubiquitin and acts as sorting machinery that recognizes ubiquitinated receptors and transfers them to further sequential lysosomal sorting/trafficking processes. Belongs to the STAM family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 10p14-p13

Cellular Component: cytosol

Molecular Function: protein binding; SH3/SH2 adaptor activity

Biological Process: autophagy; endosome transport; negative regulation of epidermal growth factor receptor signaling pathway; signal transduction

Research Articles on STAM

Similar Products

Product Notes

The STAM stam (Catalog #AAA1273747) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcttt ttgccaccaa tcccttcgat caggatgttg agaaagcaac cagcgagatg aatactgctg aggactgggg cctcattttg gatatctgtg ataaagttgg tcagtctcgc actggaccta aggattgtct tcggtctatt atgagaagag tgaaccacaa agatcctcac gttgctatgc aggctttgac tcttctagga gcatgtgtat caaactgtgg caaaattttt catttagaag tatgttcaag agattttgct agtgaagtaa gcaacgtatt aaataagggt catcctaaag tatgtgaaaa attaaaggct cttatggttg aatggacaga tgaatttaag aatgatccac agcttagtct aatatcagca atgattaaga accttaagga acaaggagtt acgttcccag ctattggctc tcaggctgca gaacaagcaa aagcaagccc agctcttgta gccaaggatc ctggtactgt ggctaacaaa aaagaagaag aagatttagc aaaagccatt gagttgtctc tcaaggaaca aaggcagcag tcaaccaccc tttccacttt gtatccaagc acatccagtc tcttaactaa ccaccaacat gaaggccgaa aagttcgtgc tatatatgac tttgaagctg ctgaagacaa tgaacttact tttaaagctg gagaaattat tacagttctt gatgacagtg atcctaactg gtggaaaggt gaaacccatc aaggcatagg gttatttcct tctaattttg tgactgcata tctcactgct gaaccagaaa tgattaaaac agagaagaag acggtacaat ttagtgatga tgttcaggta gagacaatag aaccagagcc ggaaccagcc tttattgatg aagataaaat ggaccagttg ctacagatgc tgcaaagtac agaccccagt gatgatcagc cagacctacc agagctgctt catcttgaag caatgtgtca ccagatggga cctctcattg atgaaaagct ggaagatatt gatagaaaac attcagaact ctcagaactt aatgtgaaag tgatggaggc cctttcctta tataccaagt taatgaacga agatccgatg tattccatgt atgcaaagtt acagaatcag ccaggcagtg gtcccaccat ccgcaaaccc agcccttcct ag. It is sometimes possible for the material contained within the vial of "STAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.