Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAC3 cdna clone

STAC3 cDNA Clone

Gene Names
STAC3; NAM
Synonyms
STAC3; STAC3 cDNA Clone; STAC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaacttcccccagagccccaggccaatggggaggcagtgggagctgggggtgggcccatctactacatctatgaggaagaggaagaggaagaagaggaggaggaggagccacccccagaacctcctaagctggtcaacgataagccccacaaattcaaagatcacttcttcaagaagccaaagttctgtgatgtctgtgcccggatgattgttctcaacaacaagtttgggcttcgctgtaagaactgcaaaaccaacatccatgaacactgtcagtcctatgtggaaatgcagagatgcttcggcaagatcccacctggtttccatcgggcctatagttccccactctacagcaaccagcagtacgcttgtgtcaaagatctctctgctgccaatcgcaatgatcctgtgtttgaaaccctgcgcactggggtgatcatggcaaacaaggaacggaagaagggacaggcagataagaaaaatcctgtagcagccatgatggaggaggagccagagtcggccagaccagaggaaggcaaaccccaggatggaaaccctgaaggggataagaaggctgagaagaagacacctgatgacaagcacaagcagcctggcttccagcagtctcattactttgtggctctctatcggttcaaagccctggagaaggacgatctggatttcccgccaggagagaagatcacagtcattgatgactccaatgaagaatggtggcgggggaaaatcggggagaaggtcggatttttccctccaaacttcatcattcgggtccgggctggagaacgtgtgcaccgcgtgacgagatccttcgtggggaaccgcgagatagggcagatcactctcaagaaggaccagatcgtggtgcagaaaggagacgaagcgggcggctacgtcaaggtctacaccggccgcaaggtggggctgtttcccaccgactttctagaggaaatttag
Sequence Length
978
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,304 Da
NCBI Official Full Name
Homo sapiens SH3 and cysteine rich domain 3, mRNA
NCBI Official Synonym Full Names
SH3 and cysteine rich domain 3
NCBI Official Symbol
STAC3
NCBI Official Synonym Symbols
NAM
NCBI Protein Information
SH3 and cysteine-rich domain-containing protein 3
UniProt Protein Name
SH3 and cysteine-rich domain-containing protein 3
UniProt Gene Name
STAC3
UniProt Entry Name
STAC3_HUMAN

NCBI Description

The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]

Uniprot Description

STAC3: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 12q13.3

Molecular Function: identical protein binding; protein binding

Biological Process: neuromuscular synaptic transmission; skeletal muscle contraction

Disease: Native American Myopathy

Research Articles on STAC3

Similar Products

Product Notes

The STAC3 stac3 (Catalog #AAA1276156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacttc ccccagagcc ccaggccaat ggggaggcag tgggagctgg gggtgggccc atctactaca tctatgagga agaggaagag gaagaagagg aggaggagga gccaccccca gaacctccta agctggtcaa cgataagccc cacaaattca aagatcactt cttcaagaag ccaaagttct gtgatgtctg tgcccggatg attgttctca acaacaagtt tgggcttcgc tgtaagaact gcaaaaccaa catccatgaa cactgtcagt cctatgtgga aatgcagaga tgcttcggca agatcccacc tggtttccat cgggcctata gttccccact ctacagcaac cagcagtacg cttgtgtcaa agatctctct gctgccaatc gcaatgatcc tgtgtttgaa accctgcgca ctggggtgat catggcaaac aaggaacgga agaagggaca ggcagataag aaaaatcctg tagcagccat gatggaggag gagccagagt cggccagacc agaggaaggc aaaccccagg atggaaaccc tgaaggggat aagaaggctg agaagaagac acctgatgac aagcacaagc agcctggctt ccagcagtct cattactttg tggctctcta tcggttcaaa gccctggaga aggacgatct ggatttcccg ccaggagaga agatcacagt cattgatgac tccaatgaag aatggtggcg ggggaaaatc ggggagaagg tcggattttt ccctccaaac ttcatcattc gggtccgggc tggagaacgt gtgcaccgcg tgacgagatc cttcgtgggg aaccgcgaga tagggcagat cactctcaag aaggaccaga tcgtggtgca gaaaggagac gaagcgggcg gctacgtcaa ggtctacacc ggccgcaagg tggggctgtt tcccaccgac tttctagagg aaatttag. It is sometimes possible for the material contained within the vial of "STAC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.