Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSH3 cdna clone

SSH3 cDNA Clone

Gene Names
SSH3; SSH3L
Synonyms
SSH3; SSH3 cDNA Clone; SSH3 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgctggtggcacagcgggaccgagcctcccgcatcttcccccacctctacctgggctcagagtggaacgcagcaaacctggaggagctgcagaggaacagggtcacccacatcttgaacatggcccgggagattgacaacttctaccctgagcgcttcacctaccacaatgtgcgcctctgggatgaggagtcggcccagctgctgccgcactggaaggagacgcaccgcttcattgaggctgcaagagcacagggcacccacgtgctggtccactgcaagatgggcgtcagccgctcagcggccacagtgctggcctatgccatgaagcagtacgaatgcagcctggagcaggccctgcgccacgtgcaggagctccggcccatcgcccgccccaaccctggcttcctgcgccagctgcagatctaccagggcatcctgacggccagccgccagagccatgtctgggagcagaaagtgggtggggtctccccagaggagcacccagcccctgaagtctctacaccattcccacctcttccgccagaacctgagggtggtggggaggagaaggttgtaggcatggaagagagccaggcagccccgaaagaagagcctgggccacggccacgtataaacctccgaggggtcatgaggtccatcagtcttctggagccctccttggagctggagagcacctcagagaccagtgacatgccagaggtcttctcttcccacgagtcttcacatgaagagcctctgcagcccttcccacagcttgcaaggaccaagggaggccagcaggtggacagggggcctcagcctgccctgaagtcccgccagtcagtggttaccctccagggcagtgccgtggtggccaaccggacccaggccttccaggagcaggagcaggggcaggggcaggggcagggagagccctgcatttcctctacgcccaggttccggaaggtggtgagacaggccagcgtgcatgacagtggagaggagggcgaggcctga
Sequence Length
1026
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,357 Da
NCBI Official Full Name
Homo sapiens slingshot homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
slingshot protein phosphatase 3
NCBI Official Symbol
SSH3
NCBI Official Synonym Symbols
SSH3L
NCBI Protein Information
protein phosphatase Slingshot homolog 3
UniProt Protein Name
Protein phosphatase Slingshot homolog 3
UniProt Gene Name
SSH3
UniProt Synonym Gene Names
SSH3L; SSH-3L; hSSH-3L
UniProt Entry Name
SSH3_HUMAN

NCBI Description

The ADF (actin-depolymerizing factor)/cofilin family (see MIM 601442) is composed of stimulus-responsive mediators of actin dynamics. ADF/cofilin proteins are inactivated by kinases such as LIM domain kinase-1 (LIMK1; MIM 601329). The SSH family appears to play a role in actin dynamics by reactivating ADF/cofilin proteins in vivo (Niwa et al., 2002 [PubMed 11832213]).[supplied by OMIM, Mar 2008]

Uniprot Description

SSH3: a protein phosphatase which may play a role in the regulation of actin filament dynamics. Can dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Does not bind to, or colocalize with, filamentous actin. Five alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; EC 3.1.3.16; Protein phosphatase, Ser/Thr (non-receptor); Phosphatase; Cytoskeletal; Protein phosphatase, dual-specificity; EC 3.1.3.48

Chromosomal Location of Human Ortholog: 11q13.2

Cellular Component: cytoplasm

Molecular Function: actin binding

Biological Process: regulation of actin polymerization and/or depolymerization; regulation of axonogenesis

Research Articles on SSH3

Similar Products

Product Notes

The SSH3 ssh3 (Catalog #AAA1266730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc tggtggcaca gcgggaccga gcctcccgca tcttccccca cctctacctg ggctcagagt ggaacgcagc aaacctggag gagctgcaga ggaacagggt cacccacatc ttgaacatgg cccgggagat tgacaacttc taccctgagc gcttcaccta ccacaatgtg cgcctctggg atgaggagtc ggcccagctg ctgccgcact ggaaggagac gcaccgcttc attgaggctg caagagcaca gggcacccac gtgctggtcc actgcaagat gggcgtcagc cgctcagcgg ccacagtgct ggcctatgcc atgaagcagt acgaatgcag cctggagcag gccctgcgcc acgtgcagga gctccggccc atcgcccgcc ccaaccctgg cttcctgcgc cagctgcaga tctaccaggg catcctgacg gccagccgcc agagccatgt ctgggagcag aaagtgggtg gggtctcccc agaggagcac ccagcccctg aagtctctac accattccca cctcttccgc cagaacctga gggtggtggg gaggagaagg ttgtaggcat ggaagagagc caggcagccc cgaaagaaga gcctgggcca cggccacgta taaacctccg aggggtcatg aggtccatca gtcttctgga gccctccttg gagctggaga gcacctcaga gaccagtgac atgccagagg tcttctcttc ccacgagtct tcacatgaag agcctctgca gcccttccca cagcttgcaa ggaccaaggg aggccagcag gtggacaggg ggcctcagcc tgccctgaag tcccgccagt cagtggttac cctccagggc agtgccgtgg tggccaaccg gacccaggcc ttccaggagc aggagcaggg gcaggggcag gggcagggag agccctgcat ttcctctacg cccaggttcc ggaaggtggt gagacaggcc agcgtgcatg acagtggaga ggagggcgag gcctga. It is sometimes possible for the material contained within the vial of "SSH3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.