Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSFA2 cdna clone

SSFA2 cDNA Clone

Gene Names
SSFA2; CS1; CS-1; KRAP; SPAG13
Synonyms
SSFA2; SSFA2 cDNA Clone; SSFA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgaggaggagaggtttgaagttgatcagctccagggtttgagaaattcagtccgaatggaacttcaggacctggaactgcagctggaggagcgcctgctgggcctggaggagcagcttcgtgctgtgcgcatgccttcacccttccgctcctccgcactcatgggaatgtgtggcagtagaagcgctgataacttgtcatgcccttctccattgaatgtaatggaaccagtcactgaactgatgcaggagcagtcatacctgaagtctgaattgggcctgggacttggagaaatgggatttgaaattcctcctggagaaagctcagaatctgttttttcccaagcaacatcagaatcatcttctgtatgttctggtccctctcatgctaacagaagaactggagtaccttctactgcctcagtgggcaaatccaaaaccccattagtggcaaggaagaaagtgttccgagcatcggtggctctaacgccaacagctccttctagaacaggctctgtgcagacacctccagatttggaaagttctgaggaagttgatgcagctgaaggagccccagaagttgtaggacctaaatctgaagtggaagaagggcatggaaaactcccatcaatgccagctgctgaggaaatgcataaaaatgtggagcaagatgagttgcagcaagtcatacgggagattaaagagtctattgttggggaaatcagacgggaaattgtaagtggacttttggcagcagtatcttcaagtaaagcgtctaattctaagcaagattatcattaa
Sequence Length
804
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
137,860 Da
NCBI Official Full Name
Homo sapiens sperm specific antigen 2, mRNA
NCBI Official Synonym Full Names
sperm specific antigen 2
NCBI Official Symbol
SSFA2
NCBI Official Synonym Symbols
CS1; CS-1; KRAP; SPAG13
NCBI Protein Information
sperm-specific antigen 2
UniProt Protein Name
Sperm-specific antigen 2
Protein Family
UniProt Gene Name
SSFA2
UniProt Synonym Gene Names
CS1; KIAA1927; KRAP; CS-1
UniProt Entry Name
SSFA2_HUMAN

Uniprot Description

SSFA2: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 2q31.3

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: actin filament binding

Research Articles on SSFA2

Similar Products

Product Notes

The SSFA2 ssfa2 (Catalog #AAA1271425) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgagg aggagaggtt tgaagttgat cagctccagg gtttgagaaa ttcagtccga atggaacttc aggacctgga actgcagctg gaggagcgcc tgctgggcct ggaggagcag cttcgtgctg tgcgcatgcc ttcacccttc cgctcctccg cactcatggg aatgtgtggc agtagaagcg ctgataactt gtcatgccct tctccattga atgtaatgga accagtcact gaactgatgc aggagcagtc atacctgaag tctgaattgg gcctgggact tggagaaatg ggatttgaaa ttcctcctgg agaaagctca gaatctgttt tttcccaagc aacatcagaa tcatcttctg tatgttctgg tccctctcat gctaacagaa gaactggagt accttctact gcctcagtgg gcaaatccaa aaccccatta gtggcaagga agaaagtgtt ccgagcatcg gtggctctaa cgccaacagc tccttctaga acaggctctg tgcagacacc tccagatttg gaaagttctg aggaagttga tgcagctgaa ggagccccag aagttgtagg acctaaatct gaagtggaag aagggcatgg aaaactccca tcaatgccag ctgctgagga aatgcataaa aatgtggagc aagatgagtt gcagcaagtc atacgggaga ttaaagagtc tattgttggg gaaatcagac gggaaattgt aagtggactt ttggcagcag tatcttcaag taaagcgtct aattctaagc aagattatca ttaa. It is sometimes possible for the material contained within the vial of "SSFA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.