Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SRPK3 cdna clone

SRPK3 cDNA Clone

Gene Names
SRPK3; MSSK1; STK23; MSSK-1
Synonyms
SRPK3; SRPK3 cDNA Clone; SRPK3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgccagcacgggcggtggtggggacagcggcggcagcggcggcagtagcagcagctcacaggcctcctgcgggcccgagtcctcgggctccgaactagccctggccacaccggtgcctcagatgctgcagggccttctgggctccgacgacgaggaacaggaagaccccaaagactactgcaagggcggctaccaccctgtgaagatcggcgacgtgttcaatgggcggtaccacgtggtgcgcaaactgggctggggccacttctccaccgtctggctctgctgggacatccagcgcaagcgctttgtggccctcaaagtggtgaagagtgcggggcattacacggagacagctgtggatgagatcaagctcctgaaatgtgtccgggacagcgaccccagtgaccccaaaagagagaccattgtccagctcattgatgacttcaggatctcaggagtcaatggagtccatgtgtgcatggtgctggaggtgctgggccaccagctcctcaaatggatcatcaagtccaactaccagggcctgcccgtgccctgcgtgaagagcatcgtgaggcaggtgctgcacggcctggactacctccacaccaagtgcaagatcatccacacggacatcaagcccgagaacatcttgctgtgtgtgggggacgcttacatcaggcgcctggctgccgaggccacggagtggcaacaggcaggggcgccgcccccctcccgctccatagtcagcactgccccccaggaggtcttgaccggtaagctgtccaaaaacaagaggaagaagatgaggcgcaaacggaaacagcagaagcggctgctggaggagcggctgcgggacctgcagaggctggaggccatggaggctgccacccaggctgaggactctggcttgagactagacgggggcagcggctccacatcctcttcaggctgtcaccccgggggcgccagagcaggtccctccccagcctcttcctcccccgccccggggggcggccgtagcctcagcgcgggctcacagacctcaggcttctccggctccctcttctctcctgcctcctgctccatcctctccggctcgtccaatcagcgagagaccgggggcctcctgtcgcctagcacaccattcggtgcctcgaacctcctggtgaaccccctggagccccaaaatgcagataagatcaagatcaagatcgcagacctgggcaacgcctgctgggtgcacaagcacttcacggaagacatccagactcggcagtaccgggccgtcgaggtgctgatcggcgccgaatacggccccccggcagacatctggagcacagcctgcatggccttcgagctggccactggtgactacctgttcgagccgcattctggagaagactacagtcgtgatgaggaccacatcgctcacatagtggagcttctgggggacatccccccagccttcgccctctcaggccgctattcccgggagttcttcaaccggagaggagagctgcggcacatccacaatctcaagcactggggcctgtacgaggtactcatggaaaagtacgagtggcccctagagcaggccacacagttcagcgcctttctgctgcccatgatggagtacatccccgaaaagcgggccagtgccgctgactgcctccagcacccctggctcaacccctag
Sequence Length
1701
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,886 Da
NCBI Official Full Name
Homo sapiens SFRS protein kinase 3, mRNA
NCBI Official Synonym Full Names
SRSF protein kinase 3
NCBI Official Symbol
SRPK3
NCBI Official Synonym Symbols
MSSK1; STK23; MSSK-1
NCBI Protein Information
SRSF protein kinase 3
UniProt Protein Name
SRSF protein kinase 3
Protein Family
UniProt Gene Name
SRPK3
UniProt Synonym Gene Names
MSSK1; STK23; MSSK-1; SR-protein-specific kinase 3
UniProt Entry Name
SRPK3_HUMAN

NCBI Description

This gene encodes a protein kinase similar to a protein kinase which is specific for the SR (serine/arginine-rich domain) family of splicing factors. A highly similar protein has been shown to play a role in muscle development in mice. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

SRPK3: a CMGC protein kinase of the SRPK family. Exclusively expressed in skeletal and heart muscle. Two known splice variant isoforms.

Protein type: EC 2.7.11.1; Protein kinase, CMGC; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; CMGC group; SRPK family

Chromosomal Location of Human Ortholog: Xq28

Molecular Function: protein binding

Research Articles on SRPK3

Similar Products

Product Notes

The SRPK3 srpk3 (Catalog #AAA1272361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgcca gcacgggcgg tggtggggac agcggcggca gcggcggcag tagcagcagc tcacaggcct cctgcgggcc cgagtcctcg ggctccgaac tagccctggc cacaccggtg cctcagatgc tgcagggcct tctgggctcc gacgacgagg aacaggaaga ccccaaagac tactgcaagg gcggctacca ccctgtgaag atcggcgacg tgttcaatgg gcggtaccac gtggtgcgca aactgggctg gggccacttc tccaccgtct ggctctgctg ggacatccag cgcaagcgct ttgtggccct caaagtggtg aagagtgcgg ggcattacac ggagacagct gtggatgaga tcaagctcct gaaatgtgtc cgggacagcg accccagtga ccccaaaaga gagaccattg tccagctcat tgatgacttc aggatctcag gagtcaatgg agtccatgtg tgcatggtgc tggaggtgct gggccaccag ctcctcaaat ggatcatcaa gtccaactac cagggcctgc ccgtgccctg cgtgaagagc atcgtgaggc aggtgctgca cggcctggac tacctccaca ccaagtgcaa gatcatccac acggacatca agcccgagaa catcttgctg tgtgtggggg acgcttacat caggcgcctg gctgccgagg ccacggagtg gcaacaggca ggggcgccgc ccccctcccg ctccatagtc agcactgccc cccaggaggt cttgaccggt aagctgtcca aaaacaagag gaagaagatg aggcgcaaac ggaaacagca gaagcggctg ctggaggagc ggctgcggga cctgcagagg ctggaggcca tggaggctgc cacccaggct gaggactctg gcttgagact agacgggggc agcggctcca catcctcttc aggctgtcac cccgggggcg ccagagcagg tccctcccca gcctcttcct cccccgcccc ggggggcggc cgtagcctca gcgcgggctc acagacctca ggcttctccg gctccctctt ctctcctgcc tcctgctcca tcctctccgg ctcgtccaat cagcgagaga ccgggggcct cctgtcgcct agcacaccat tcggtgcctc gaacctcctg gtgaaccccc tggagcccca aaatgcagat aagatcaaga tcaagatcgc agacctgggc aacgcctgct gggtgcacaa gcacttcacg gaagacatcc agactcggca gtaccgggcc gtcgaggtgc tgatcggcgc cgaatacggc cccccggcag acatctggag cacagcctgc atggccttcg agctggccac tggtgactac ctgttcgagc cgcattctgg agaagactac agtcgtgatg aggaccacat cgctcacata gtggagcttc tgggggacat ccccccagcc ttcgccctct caggccgcta ttcccgggag ttcttcaacc ggagaggaga gctgcggcac atccacaatc tcaagcactg gggcctgtac gaggtactca tggaaaagta cgagtggccc ctagagcagg ccacacagtt cagcgccttt ctgctgccca tgatggagta catccccgaa aagcgggcca gtgccgctga ctgcctccag cacccctggc tcaaccccta g. It is sometimes possible for the material contained within the vial of "SRPK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.