Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SREBF1 cdna clone

SREBF1 cDNA Clone

Gene Names
SREBF1; SREBP1; bHLHd1; SREBP1a; SREBP-1c
Synonyms
SREBF1; SREBF1 cDNA Clone; SREBF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgagccacccttcagcgaggcggctttggagcaggcgctgggcgagccgtgcgatctggacgcggcgctgctgaccgacatcgaagacatgcttcagcttatcaacaaccaagacagtgacttccctggcctatttgacccaccctatgctgggagtggggcagggggcacagaccctgccagccccgataccagctccccaggcagcttgtctccacctcctgccacattgagctcctctcttgaagccttcctgagcgggccgcaggcagcgccctcacccctgtcccctccccagcctgcacccactccattgaagatgtacccgtccatgcccgctttctcccctgggcctggtatcaaggaagagtcagtgccactgagcatcctgcagacccccaccccacagcccctgccaggggccctcctgccacagagcttcccagccccagccccaccgcagttcagctccacccctgtgttaggctaccccagccctccgggaggcttctctacaggaagccctcccgggaacacccagcagccgctgcctggcctgccactggcttccccgccaggggtcccgcccgtctccttgcacacccaggtccagagtgtggtcccccagcagctactgacagtcacagctgcccccacggcagcccctgtaacgaccactgtgacctcgcagatccagcaggtcccggtcctgctgcagccccacttcatcaaggcagactcgctgcttctgacagccatgaagacagacggagccactgtgaaggcggcaggtctcagtcccctggtctctggcaccactgtgcagacagggcctttgccgaccctggtgagtggcggaaccatcttggcaacagtcccactggtcgtagatgcggagaagctgcctatcaaccggctcgcagctggcagcaaggccccggcctctgcccagagccgtggagagaagcgcacagcccacaacgccattgagaagcgctaccgctcctccatcaatgacaaaatcattgagctcaaggatctggtggtgggcactgaggcaaagctgaataaatctgctgtcttgcgcaaggccatcgactacattcgctttctgcaacacagcaaccagaaactcaagcaggagaacctaagtctgcgcactgctgtccacaaaagcaaatctctgaaggatctggtgtcggcctgtggcagtggagggaacacagacgtgctcatggagggcgtgaagactgaggtggaggacacactgaccccacccccctcggatgctggctcacctttccagagcagccccttgtcccttggcagcaggggcagtggcagcggtggcagtggcagtgactcggagcctgacagcccagtctttgaggacagcaaggcaaagccagagcagcggccgtctctgcacagccggggcatgctggaccgctcccgcctggccctgtgcacgctcgtcttcctctgcctgtcctgcaaccccttggcctccttgctgggggcccgggggcttcccagcccctcagataccaccagcgtctaccatagccctgggcgcaacgtgctgggcaccgagagcagagatggccctggctgggcccagtggctgctgcccccagtggtctggctgctcaatgggctgttggtgctcgtctccttggtgcttctctttgtctacggtgagccagtcacacggccccactcaggccccgccgtgtacttctggaggcatcgcaagcaggctgacctggacctggcccggggagactttgcccaggctgcccagcagctgtggctggccctgcgggcactgggccggcccctgcccacctcccacctggacctggcttgtagcctcctctggaacctcattcgtcacctgctgcagcgtctctgggtgggccgctggctggcaggccgggcagggggcctgcagcaggactgtgctctgcgagtggatgctagcgccagcgcccgagacgcagccctggtctaccataagctgcaccagctgcacaccatggggaagcacacaggcgggcacctcactgccaccaacctggcgctgagtgccctgaacctggcagagtgtgcaggggatgccgtgtctgtggcgacgctggccgagatctatgtggcggctgcattgagagtgaagaccagtctcccacgggccttgcattttctgacacgcttcttcctgagcagtgcccgccaggcctgcctggcacagagtggctcagtgcctcctgccatgcagtggctctgccaccccgtgggccaccgtttcttcgtggatggggactggtccgtgctcagtaccccatgggagagcctgtacagcttggccgggaacccagtggaccccctggcccaggtgactcagctattccgggaacatctcttagagcgagcactgaactgtgtgacccagcccaaccccagccctgggtcagctgatggggacaaggaattctcggatgccctcgggtacctgcagctgctgaacagctgttctgatgctgcgggggctcctgcctacagcttctccatcagttccagcatggccaccaccaccggcgtagacccggtggccaagtggtgggcctctctgacagctgtggtgatccactggctgcggcgggatgaggaggcggctgagcggctgtgcccgctggtggagcacctgccccgggtgctgcaggagtctgagagacccctgcccagggcagctctgcactccttcaaggctgcccgggccctgctgggctgtgccaaggcagagtctggtccagccagcctgaccatctgtgagaaggccagtgggtacctgcaggacagcctggctaccacaccagccagcagctccattgacaaggccgtgcagctgttcctgtgtgacctgcttcttgtggtgcgcaccagcctgtggcggcagcagcagcccccggccccggccccagcagcccagggcaccagcagcaggccccaggcttccgcccttgagctgcgtggcttccaacgggacctgagcagcctgaggcggctggcacagagcttccggcccgccatgcggagggtgttcctacatgaggccacggcccggctgatggcgggggccagccccacacggacacaccagctcctcgaccgcagtctgaggcggcgggcaggccccggtggcaaaggaggcgcggtggcggagctggagccgcggcccacgcggcgggagcacgcggaggccttgctgctggcctcctgctacctgccccccggcttcctgtcggcgcccgggcagcgcgtgggcatgctggctgaggcggcgcgcacactcgagaagcttggcgatcgccggctgctgcacgactgtcagcagatgctcatgcgcctgggcggtgggaccactgtcacttccagctag
Sequence Length
3444
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,816 Da
NCBI Official Full Name
Homo sapiens sterol regulatory element binding transcription factor 1, mRNA
NCBI Official Synonym Full Names
sterol regulatory element binding transcription factor 1
NCBI Official Symbol
SREBF1
NCBI Official Synonym Symbols
SREBP1; bHLHd1; SREBP1a; SREBP-1c
NCBI Protein Information
sterol regulatory element-binding protein 1
UniProt Protein Name
Sterol regulatory element-binding protein 1
UniProt Gene Name
SREBF1
UniProt Synonym Gene Names
BHLHD1; SREBP1; SREBP-1; bHLHd1
UniProt Entry Name
SRBP1_HUMAN

NCBI Description

This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Mar 2016]

Uniprot Description

SREBP-1: Transcriptional activator required for lipid homeostasis. Regulates transcription of the LDL receptor gene as well as the fatty acid and to a lesser degree the cholesterol synthesis pathway. Binds to the sterol regulatory element 1 (SRE-1) (5'-ATCACCCCAC-3'). Has dual sequence specificity binding to both an E-box motif (5'-ATCACGTGA-3') and to SRE-1 (5'-ATCACCCCAC-3'). Forms a tight complex with SCAP in the ER membrane. Efficient DNA binding of the soluble transcription factor fragment requires dimerization with another bHLH protein. Interacts with LMNA. Expressed in a wide variety of tissues, most abundant in liver and adrenal gland. In fetal tissues lung and liver shows highest expression. Isoform SREBP-1C predominates in liver, adrenal gland and ovary, whereas isoform SREBP-1A predominates in hepatoma cell lines. Isoform SREBP-1A and isoform SREBP-1C are found in kidney, brain, white fat, and muscle. Belongs to the SREBP family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Membrane protein, integral; Membrane protein, multi-pass; Transcription factor

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum membrane; Golgi membrane; nuclear envelope; nucleoplasm; nucleus

Molecular Function: DNA binding; ligand-dependent nuclear receptor activity; protein binding; sterol response element binding; transcription factor activity

Biological Process: cellular response to starvation; circadian rhythm; lipid biosynthetic process; lipid metabolic process; positive regulation of transcription from RNA polymerase II promoter; regulation of protein stability; regulation of transcription from RNA polymerase II promoter

Research Articles on SREBF1

Similar Products

Product Notes

The SREBF1 srebf1 (Catalog #AAA1268200) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagc cacccttcag cgaggcggct ttggagcagg cgctgggcga gccgtgcgat ctggacgcgg cgctgctgac cgacatcgaa gacatgcttc agcttatcaa caaccaagac agtgacttcc ctggcctatt tgacccaccc tatgctggga gtggggcagg gggcacagac cctgccagcc ccgataccag ctccccaggc agcttgtctc cacctcctgc cacattgagc tcctctcttg aagccttcct gagcgggccg caggcagcgc cctcacccct gtcccctccc cagcctgcac ccactccatt gaagatgtac ccgtccatgc ccgctttctc ccctgggcct ggtatcaagg aagagtcagt gccactgagc atcctgcaga cccccacccc acagcccctg ccaggggccc tcctgccaca gagcttccca gccccagccc caccgcagtt cagctccacc cctgtgttag gctaccccag ccctccggga ggcttctcta caggaagccc tcccgggaac acccagcagc cgctgcctgg cctgccactg gcttccccgc caggggtccc gcccgtctcc ttgcacaccc aggtccagag tgtggtcccc cagcagctac tgacagtcac agctgccccc acggcagccc ctgtaacgac cactgtgacc tcgcagatcc agcaggtccc ggtcctgctg cagccccact tcatcaaggc agactcgctg cttctgacag ccatgaagac agacggagcc actgtgaagg cggcaggtct cagtcccctg gtctctggca ccactgtgca gacagggcct ttgccgaccc tggtgagtgg cggaaccatc ttggcaacag tcccactggt cgtagatgcg gagaagctgc ctatcaaccg gctcgcagct ggcagcaagg ccccggcctc tgcccagagc cgtggagaga agcgcacagc ccacaacgcc attgagaagc gctaccgctc ctccatcaat gacaaaatca ttgagctcaa ggatctggtg gtgggcactg aggcaaagct gaataaatct gctgtcttgc gcaaggccat cgactacatt cgctttctgc aacacagcaa ccagaaactc aagcaggaga acctaagtct gcgcactgct gtccacaaaa gcaaatctct gaaggatctg gtgtcggcct gtggcagtgg agggaacaca gacgtgctca tggagggcgt gaagactgag gtggaggaca cactgacccc acccccctcg gatgctggct cacctttcca gagcagcccc ttgtcccttg gcagcagggg cagtggcagc ggtggcagtg gcagtgactc ggagcctgac agcccagtct ttgaggacag caaggcaaag ccagagcagc ggccgtctct gcacagccgg ggcatgctgg accgctcccg cctggccctg tgcacgctcg tcttcctctg cctgtcctgc aaccccttgg cctccttgct gggggcccgg gggcttccca gcccctcaga taccaccagc gtctaccata gccctgggcg caacgtgctg ggcaccgaga gcagagatgg ccctggctgg gcccagtggc tgctgccccc agtggtctgg ctgctcaatg ggctgttggt gctcgtctcc ttggtgcttc tctttgtcta cggtgagcca gtcacacggc cccactcagg ccccgccgtg tacttctgga ggcatcgcaa gcaggctgac ctggacctgg cccggggaga ctttgcccag gctgcccagc agctgtggct ggccctgcgg gcactgggcc ggcccctgcc cacctcccac ctggacctgg cttgtagcct cctctggaac ctcattcgtc acctgctgca gcgtctctgg gtgggccgct ggctggcagg ccgggcaggg ggcctgcagc aggactgtgc tctgcgagtg gatgctagcg ccagcgcccg agacgcagcc ctggtctacc ataagctgca ccagctgcac accatgggga agcacacagg cgggcacctc actgccacca acctggcgct gagtgccctg aacctggcag agtgtgcagg ggatgccgtg tctgtggcga cgctggccga gatctatgtg gcggctgcat tgagagtgaa gaccagtctc ccacgggcct tgcattttct gacacgcttc ttcctgagca gtgcccgcca ggcctgcctg gcacagagtg gctcagtgcc tcctgccatg cagtggctct gccaccccgt gggccaccgt ttcttcgtgg atggggactg gtccgtgctc agtaccccat gggagagcct gtacagcttg gccgggaacc cagtggaccc cctggcccag gtgactcagc tattccggga acatctctta gagcgagcac tgaactgtgt gacccagccc aaccccagcc ctgggtcagc tgatggggac aaggaattct cggatgccct cgggtacctg cagctgctga acagctgttc tgatgctgcg ggggctcctg cctacagctt ctccatcagt tccagcatgg ccaccaccac cggcgtagac ccggtggcca agtggtgggc ctctctgaca gctgtggtga tccactggct gcggcgggat gaggaggcgg ctgagcggct gtgcccgctg gtggagcacc tgccccgggt gctgcaggag tctgagagac ccctgcccag ggcagctctg cactccttca aggctgcccg ggccctgctg ggctgtgcca aggcagagtc tggtccagcc agcctgacca tctgtgagaa ggccagtggg tacctgcagg acagcctggc taccacacca gccagcagct ccattgacaa ggccgtgcag ctgttcctgt gtgacctgct tcttgtggtg cgcaccagcc tgtggcggca gcagcagccc ccggccccgg ccccagcagc ccagggcacc agcagcaggc cccaggcttc cgcccttgag ctgcgtggct tccaacggga cctgagcagc ctgaggcggc tggcacagag cttccggccc gccatgcgga gggtgttcct acatgaggcc acggcccggc tgatggcggg ggccagcccc acacggacac accagctcct cgaccgcagt ctgaggcggc gggcaggccc cggtggcaaa ggaggcgcgg tggcggagct ggagccgcgg cccacgcggc gggagcacgc ggaggccttg ctgctggcct cctgctacct gccccccggc ttcctgtcgg cgcccgggca gcgcgtgggc atgctggctg aggcggcgcg cacactcgag aagcttggcg atcgccggct gctgcacgac tgtcagcaga tgctcatgcg cctgggcggt gggaccactg tcacttccag ctag. It is sometimes possible for the material contained within the vial of "SREBF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.