Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPOPL cdna clone

SPOPL cDNA Clone

Gene Names
SPOPL; BTBD33
Synonyms
SPOPL; SPOPL cDNA Clone; SPOPL cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgggaacccaccccacctctacctggagatatgtctactggtcccatagcagaaagctggtgttacacacaggttaaagtagtaaaattttcctatatgtggaccattaataacttcagtttttgtcgagaggaaatgggtgaagtgttaaaaagttcaacattttcatctggcccaagtgacaaaatgaaatggtgcctgagggtaaacccaaagggattagatgatgaaagtaaagactacttgtccttatatttgcttttagtcagctgccccaaaagtgaagttcgagcaaaattcaaattttcccttctgaatgctaaaagggaagaaacaaaagcaatggaaagccaaagagcatatcgatttgtgcaagggaaggactggggttttaaaaaattcattagaagggactttttgcttgatgaagctaatggtcttttaccagatgacaagcttacattattttgtgaggtgagtgtggtccaagattcagtaaacatatcaggacatactaatacaaatactttgaaggtgcctgagtgtcgtctagcagaagatttaggtaatctctgggaaaacacaagatttacagactgcagttttttcgtgagaggacaagaatttaaagctcataaatctgtgcttgcagctcgatctccagtttttaacgccatgtttgaacatgaaatggaagaaagcaaaaagaatcgagtggaaataaatgatttagaccctgaagtttttaaagaaatgatgagattcatttacacagggagagcaccaaaccttgacaaaatggctgacaacttgttggcagctgcagacaaatatgcactggaacggctgaaggtcatgtgcgaagaagctttgtgtagtaacctctcagtagagaatgttgcagatacccttgtccttgcagatttgcacagtgcagaacagttgaaagcacaagccatagactttattaataggtgcagtgtacttcgacaacttgggtgtaaagatgggaaaaactggaacagcaaccaagcaaccgacataatggaaacatcagggtggaagtccatgattcagtctcaccctcatttagtagcagaagcctttcgagcactagcatctgcacagtgtccacagtttggcattccacgcaaacggctaaaacagtcctga
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,647 Da
NCBI Official Full Name
Homo sapiens speckle-type POZ protein-like, mRNA
NCBI Official Synonym Full Names
speckle type BTB/POZ protein like
NCBI Official Symbol
SPOPL
NCBI Official Synonym Symbols
BTBD33
NCBI Protein Information
speckle-type POZ protein-like
UniProt Protein Name
Speckle-type POZ protein-like
Protein Family
UniProt Gene Name
SPOPL
UniProt Entry Name
SPOPL_HUMAN

Uniprot Description

SPOPL: In complex with a cullin, may act in ubiquitination and proteasomal degradation processes. Belongs to the Tdpoz family.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 2q22.1

Cellular Component: cytoplasm; nucleus; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: negative regulation of protein ubiquitination; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of proteolysis

Similar Products

Product Notes

The SPOPL spopl (Catalog #AAA1269633) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcggg aacccacccc acctctacct ggagatatgt ctactggtcc catagcagaa agctggtgtt acacacaggt taaagtagta aaattttcct atatgtggac cattaataac ttcagttttt gtcgagagga aatgggtgaa gtgttaaaaa gttcaacatt ttcatctggc ccaagtgaca aaatgaaatg gtgcctgagg gtaaacccaa agggattaga tgatgaaagt aaagactact tgtccttata tttgctttta gtcagctgcc ccaaaagtga agttcgagca aaattcaaat tttcccttct gaatgctaaa agggaagaaa caaaagcaat ggaaagccaa agagcatatc gatttgtgca agggaaggac tggggtttta aaaaattcat tagaagggac tttttgcttg atgaagctaa tggtctttta ccagatgaca agcttacatt attttgtgag gtgagtgtgg tccaagattc agtaaacata tcaggacata ctaatacaaa tactttgaag gtgcctgagt gtcgtctagc agaagattta ggtaatctct gggaaaacac aagatttaca gactgcagtt ttttcgtgag aggacaagaa tttaaagctc ataaatctgt gcttgcagct cgatctccag tttttaacgc catgtttgaa catgaaatgg aagaaagcaa aaagaatcga gtggaaataa atgatttaga ccctgaagtt tttaaagaaa tgatgagatt catttacaca gggagagcac caaaccttga caaaatggct gacaacttgt tggcagctgc agacaaatat gcactggaac ggctgaaggt catgtgcgaa gaagctttgt gtagtaacct ctcagtagag aatgttgcag atacccttgt ccttgcagat ttgcacagtg cagaacagtt gaaagcacaa gccatagact ttattaatag gtgcagtgta cttcgacaac ttgggtgtaa agatgggaaa aactggaaca gcaaccaagc aaccgacata atggaaacat cagggtggaa gtccatgatt cagtctcacc ctcatttagt agcagaagcc tttcgagcac tagcatctgc acagtgtcca cagtttggca ttccacgcaa acggctaaaa cagtcctga. It is sometimes possible for the material contained within the vial of "SPOPL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.