Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPOP cdna clone

SPOP cDNA Clone

Gene Names
SPOP; TEF2; BTBD32
Synonyms
SPOP; SPOP cDNA Clone; SPOP cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaagggttccaagtcctccacctccggcagaaatgtcgagtggccccgtagctgagagttggtgctacacacagatcaaggtagtgaaattctcctacatgtggaccatcaataactttagcttttgccgggaggaaatgggtgaagtcattaaaagttctacattttcatcaggagcaaatgataaactgaaatggtgtttgcgagtaaaccccaaagggttagatgaagaaagcaaagattacctgtcactttacctgttactggtcagctgtccaaagagtgaagttcgggcaaaattcaaattctccatcctgaatgccaagggagaagaaaccaaagctatggagagtcaacgggcatataggtttgtgcaaggcaaagactggggattcaagaaattcatccgtagagattttcttttggatgaggccaacgggcttctccctgatgacaagcttaccctcttctgcgaggtgagtgttgtgcaagattctgtcaacatttctggccagaataccatgaacatggtaaaggttcctgagtgccggctggcagatgagttaggaggactgtgggagaattcccggttcacagactgctgcttgtgtgttgccggccaggaattccaggctcacaaggctatcttagcagctcgttctccggtttttagtgccatgtttgaacatgaaatggaggagagcaaaaagaatcgagttgaaatcaatgatgtggagcctgaagtttttaaggaaatgatgtgcttcatttacacggggaaggctccaaacctcgacaaaatggctgatgatttgctggcagctgctgacaagtatgccctggagcgcttaaaggtcatgtgtgaggatgccctctgcagtaacctgtccgtggagaacgctgcagaaattctcatcctggccgacctccacagtgcagatcagttgaaaactcaggcagtggatttcatcaactatcatgcttcggatgtcttggagacctctgggtggaagtcaatggtggtgtcacatccccacttggtggctgaggcataccgctctctggcttcagcacagtgcccttttctgggacccccacgcaaacgcctgaagcaatcctaa
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,132 Da
NCBI Official Full Name
Homo sapiens speckle-type POZ protein, mRNA
NCBI Official Synonym Full Names
speckle type BTB/POZ protein
NCBI Official Symbol
SPOP
NCBI Official Synonym Symbols
TEF2; BTBD32
NCBI Protein Information
speckle-type POZ protein
UniProt Protein Name
Speckle-type POZ protein
Protein Family
UniProt Gene Name
SPOP
UniProt Entry Name
SPOP_HUMAN

NCBI Description

This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]

Uniprot Description

SPOP: Inhibits IPF1/PDX1 transactivation of established target promoters, such as insulin, may be by recruiting a repressor complex. In complex with CUL3, involved in ubiquitination of BMI1, H2AFY and DAXX, and probably also in ubiquitination and proteasomal degradation of Gli2 or Gli3. Belongs to the Tdpoz family.

Chromosomal Location of Human Ortholog: 17q21.33

Cellular Component: cytoplasm; nucleoplasm; nucleus; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of proteolysis

Research Articles on SPOP

Similar Products

Product Notes

The SPOP spop (Catalog #AAA1267634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaggg ttccaagtcc tccacctccg gcagaaatgt cgagtggccc cgtagctgag agttggtgct acacacagat caaggtagtg aaattctcct acatgtggac catcaataac tttagctttt gccgggagga aatgggtgaa gtcattaaaa gttctacatt ttcatcagga gcaaatgata aactgaaatg gtgtttgcga gtaaacccca aagggttaga tgaagaaagc aaagattacc tgtcacttta cctgttactg gtcagctgtc caaagagtga agttcgggca aaattcaaat tctccatcct gaatgccaag ggagaagaaa ccaaagctat ggagagtcaa cgggcatata ggtttgtgca aggcaaagac tggggattca agaaattcat ccgtagagat tttcttttgg atgaggccaa cgggcttctc cctgatgaca agcttaccct cttctgcgag gtgagtgttg tgcaagattc tgtcaacatt tctggccaga ataccatgaa catggtaaag gttcctgagt gccggctggc agatgagtta ggaggactgt gggagaattc ccggttcaca gactgctgct tgtgtgttgc cggccaggaa ttccaggctc acaaggctat cttagcagct cgttctccgg tttttagtgc catgtttgaa catgaaatgg aggagagcaa aaagaatcga gttgaaatca atgatgtgga gcctgaagtt tttaaggaaa tgatgtgctt catttacacg gggaaggctc caaacctcga caaaatggct gatgatttgc tggcagctgc tgacaagtat gccctggagc gcttaaaggt catgtgtgag gatgccctct gcagtaacct gtccgtggag aacgctgcag aaattctcat cctggccgac ctccacagtg cagatcagtt gaaaactcag gcagtggatt tcatcaacta tcatgcttcg gatgtcttgg agacctctgg gtggaagtca atggtggtgt cacatcccca cttggtggct gaggcatacc gctctctggc ttcagcacag tgcccttttc tgggaccccc acgcaaacgc ctgaagcaat cctaa. It is sometimes possible for the material contained within the vial of "SPOP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.