SPG11 cdna clone
SPG11 cDNA Clone
Gene Names
SPG11; ALS5; CMT2X; KIAA1840
Synonyms
SPG11; SPG11 cDNA Clone; SPG11 cdna clone
Sequence
atggggcgggttctaccgatgctgttggtgccagtccccgccgaggcgatggggcagctcggctcccgggcgcagctgcgcacacagccggaggctctggggagcctgacggctgcgggcagcctccaagtgctttctttgacgcctggcagccggggcgggggtcgctgctgcctggagggccccttctggcactttctatgggaggattctcgtaacagcagcacaccaactgaaaagcccaaactgctcgctcttggtgaaaattatgaactgcttatctatgaatttaatttgaaagatggaagatgtgatgcaaccattttgtatagctgtagtagggaggcattgcaaaagctcattgacgatcaagatatcagtatttccttattgtctttgagaatcctgtcatttcacaataacacatcattactgttcatcaacaaatgtgtcatcctacatattatatttcctgaaagagatgctgcaattagagtactcaactgtttcacacttcccttgcctgcacaggcagtggacatgattattgacacgcagctctgcagaggaattctttttgttttgagtagtttaggctggatctacatttttgatgttgtggatggtacatatgtagctcatgtggatttagcacttcacaaagaagacatgtgtaatgagcagcaacaggagccagccaagatttcttcatttacttcactgaaagtttctcaagacctcgatgttgcagtgattgtcagctcctccaactccgcagttgctcttaacttaaatttgtatttcaggcaacacccaggacacctactgtgtgaaagaatactagaagatcttcctattcaaggacctaagggcgtagatgaagatgatcctgttaactctgcctacaacatgaaactggcaaagttttccttccaaattgataggtcttggaaagcccagctatcatcattggatgaaacaataaagaactccaaactggaggtttcctgttgtgctccatggttccaggatattttgcatttggagtcacctgaatctggtaaccacagtacaagtgtgcagagctgggccttcattccacaggacataatgcatgggcaatataatgttctacagaaagatcatgccaagaccagtgatccaggaagatcatggaaaataatgcacatcagtgaacaagaggaacccatagagcttaaatgtgtgtctgtgacaggattcactgcactgtttacttgggaagtggaaaggatgggctataccattaccctctgggatttggagacccagggcatgcagtgtttttcccttggcacaaagtgtattcctgtagacagtagtggagaccagcagctgtgctttgttttgacagagaatggactctctctgattttgtttggtttgactcaagaagagtttttaaacagactcatgatccatggaagtgccagcactgtggacactctttgtcatctcaatggctggggaaggtgctcaattcccatacatgcactagaggccgggatagaaaatcgtcagctggacacagtaaatttctttttgaagagcaaggaaaatctttttaatccatcctcaaaatcttctgtatctgatcagtttgatcacttgtcatcccatttatatttaagaaatgtggaagagctgataccagcattggatttactttgctcggcaattagagaaagttattctgaaccccaaagcaaacacttttcagaacaattgcttaatcttacactgtctttccttaacaaccaaataaaggagcttttcattcacactgaagaactagatgaacatctgcaaaaaggagtgaacattttgactagctacattaatgaacttcgaaccttcatgataaagtttccttggaagctaacagatgctatagatgaatatgatgtacatgaaaatgtccccaaagtaaaggagagcaatatatggaagaaactcagctttgaggaagttattgccagcgccattttaaacaacaaaataccagaggcacagactttcttcaggattgatagtcattctgctcaaaaacttgaggagcttattggcataggcctaaatttggtctttgacaatttaaaaaagaacaatataaaggaagcctctgaacttttgaagaatatggggtttgatgtaaaaggccaattgctcaagatctgcttctatacaactaataaaaatatacgtgactttttggtaggtaaaggtgagactacatag
Sequence Length
2277
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
266,643 Da
NCBI Official Full Name
Homo sapiens KIAA1840, mRNA
NCBI Official Synonym Full Names
spastic paraplegia 11 (autosomal recessive)
NCBI Official Symbol
SPG11
NCBI Official Synonym Symbols
ALS5; CMT2X; KIAA1840
NCBI Protein Information
spatacsin
UniProt Protein Name
Spatacsin
Protein Family
UniProt Gene Name
SPG11
UniProt Synonym Gene Names
KIAA1840
UniProt Entry Name
SPTCS_HUMAN
NCBI Description
The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Uniprot Description
SPG11: Defects in SPG11 are the cause of spastic paraplegia autosomal recessive type 11 (SPG11). Spastic paraplegia is a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 15q14
Cellular Component: cytoplasm; cytoplasmic vesicle; cytosol; lysosomal membrane; nucleolus; plasma membrane; synapse
Molecular Function: protein binding
Biological Process: axon cargo transport; synaptic transmission; synaptic vesicle transport
Disease: Charcot-marie-tooth Disease, Axonal, Type 2x; Spastic Paraplegia 11, Autosomal Recessive
Research Articles on SPG11
Similar Products
Product Notes
The SPG11 spg11 (Catalog #AAA1276226) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcggg ttctaccgat gctgttggtg ccagtccccg ccgaggcgat ggggcagctc ggctcccggg cgcagctgcg cacacagccg gaggctctgg ggagcctgac ggctgcgggc agcctccaag tgctttcttt gacgcctggc agccggggcg ggggtcgctg ctgcctggag ggccccttct ggcactttct atgggaggat tctcgtaaca gcagcacacc aactgaaaag cccaaactgc tcgctcttgg tgaaaattat gaactgctta tctatgaatt taatttgaaa gatggaagat gtgatgcaac cattttgtat agctgtagta gggaggcatt gcaaaagctc attgacgatc aagatatcag tatttcctta ttgtctttga gaatcctgtc atttcacaat aacacatcat tactgttcat caacaaatgt gtcatcctac atattatatt tcctgaaaga gatgctgcaa ttagagtact caactgtttc acacttccct tgcctgcaca ggcagtggac atgattattg acacgcagct ctgcagagga attctttttg ttttgagtag tttaggctgg atctacattt ttgatgttgt ggatggtaca tatgtagctc atgtggattt agcacttcac aaagaagaca tgtgtaatga gcagcaacag gagccagcca agatttcttc atttacttca ctgaaagttt ctcaagacct cgatgttgca gtgattgtca gctcctccaa ctccgcagtt gctcttaact taaatttgta tttcaggcaa cacccaggac acctactgtg tgaaagaata ctagaagatc ttcctattca aggacctaag ggcgtagatg aagatgatcc tgttaactct gcctacaaca tgaaactggc aaagttttcc ttccaaattg ataggtcttg gaaagcccag ctatcatcat tggatgaaac aataaagaac tccaaactgg aggtttcctg ttgtgctcca tggttccagg atattttgca tttggagtca cctgaatctg gtaaccacag tacaagtgtg cagagctggg ccttcattcc acaggacata atgcatgggc aatataatgt tctacagaaa gatcatgcca agaccagtga tccaggaaga tcatggaaaa taatgcacat cagtgaacaa gaggaaccca tagagcttaa atgtgtgtct gtgacaggat tcactgcact gtttacttgg gaagtggaaa ggatgggcta taccattacc ctctgggatt tggagaccca gggcatgcag tgtttttccc ttggcacaaa gtgtattcct gtagacagta gtggagacca gcagctgtgc tttgttttga cagagaatgg actctctctg attttgtttg gtttgactca agaagagttt ttaaacagac tcatgatcca tggaagtgcc agcactgtgg acactctttg tcatctcaat ggctggggaa ggtgctcaat tcccatacat gcactagagg ccgggataga aaatcgtcag ctggacacag taaatttctt tttgaagagc aaggaaaatc tttttaatcc atcctcaaaa tcttctgtat ctgatcagtt tgatcacttg tcatcccatt tatatttaag aaatgtggaa gagctgatac cagcattgga tttactttgc tcggcaatta gagaaagtta ttctgaaccc caaagcaaac acttttcaga acaattgctt aatcttacac tgtctttcct taacaaccaa ataaaggagc ttttcattca cactgaagaa ctagatgaac atctgcaaaa aggagtgaac attttgacta gctacattaa tgaacttcga accttcatga taaagtttcc ttggaagcta acagatgcta tagatgaata tgatgtacat gaaaatgtcc ccaaagtaaa ggagagcaat atatggaaga aactcagctt tgaggaagtt attgccagcg ccattttaaa caacaaaata ccagaggcac agactttctt caggattgat agtcattctg ctcaaaaact tgaggagctt attggcatag gcctaaattt ggtctttgac aatttaaaaa agaacaatat aaaggaagcc tctgaacttt tgaagaatat ggggtttgat gtaaaaggcc aattgctcaa gatctgcttc tatacaacta ataaaaatat acgtgacttt ttggtaggta aaggtgagac tacatag. It is sometimes possible for the material contained within the vial of "SPG11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
